1 / 14

Mutations

Mutations. TACGCACATTTACGTACGCGG. DNA. mRNA. AUG CGU GUA AAU GCA UGC GCC. protein. aa. aa. aa. aa. aa. aa. aa. aa. trait. Genes. Genes code for proteins the order of A, T, C & G Proteins create traits. trait. Transcription & Translation. Genes code for proteins through…

hermione
Download Presentation

Mutations

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript

  1. Mutations

  2. TACGCACATTTACGTACGCGG DNA mRNA AUGCGUGUAAAUGCAUGCGCC protein aa aa aa aa aa aa aa aa trait Genes • Genes code for proteins • the order of A, T, C & G • Proteins create traits

  3. trait Transcription & Translation • Genes code for proteins through… • transcription • translation

  4. Mutations • Mutations are changes in DNA sequences • changes to the order of A, T, C & G • different order = different amino acid in protein • different protein structure = different protein function BB Bb bb

  5. Mutations • Point mutations • single base change • silent mutation • no amino acid change • redundancy in code • missense • change amino acid • nonsense • change to stop codon

  6. Point mutation leads to Sickle cell anemia What kind of mutation? Missense!

  7. Sickle cell anemia • Primarily Africans • recessive inheritance pattern • strikes 1 out of 400 African Americans

  8. Mutations • Frameshift • shift in the reading frame • changes everything “downstream” • insertions • adding base(s) • deletions • losing base(s) Where would this mutation cause the most change:beginning or end of gene?

  9. Frameshift mutations THERATANDTHECATATETHEREDBAT THERATANDTHECATATETHEREDBAT Deletion THERTANDTHECATATETHEREDBAT THERTANDTHECATATETHEREDBAT Insertion THERAATANDTHECATATETHEREDBAT THERAATANDTHECATATETHEREDBAT

  10. Cystic fibrosis • Primarily whites of European descent • strikes 1 in 2500 births • 1 in 25 whites is a carrier (Aa) • normal allele codes for a membrane protein that moves Cl- across cell membrane • mutant channel limit movement of Cl- (& H2O) across cell membrane • thicker & stickier mucus coats cells • mucus build-up in the pancreas, lungs, digestive tract & causes bacterial infections • without treatment children die before 5; with treatment can live past their late 20s

  11. Chloride channel transports chloride through protein channel out of cell Osmotic effects: H2O follows Cl- Effect on Lungs normal lungs airway Cl- Cl- channel H2O cells lining lungs cystic fibrosis Cl- H2O bacteria & mucus build up thickened mucus hard to secrete mucus secreting glands

  12. What’s the value ofmutations?

  13. Point mutation leads to Sickle cell anemia What kind of mutation?

More Related