1 / 47

From DNA to Protein: Genotype to Phenotype

From DNA to Protein: Genotype to Phenotype. Biochemical Biosynthesis Pathways Lead to Understanding of Gene-Enzyme Relationship. Biosynthesis of Arginine. Ornithine transcarbamylase. Argininosuccinate lyase. Argininosuccinate synthetase. Acetylornithinase. N-acetylornithine. Ornithine.

holmes-soto
Download Presentation

From DNA to Protein: Genotype to Phenotype

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript

  1. From DNA to Protein: Genotype to Phenotype

  2. Biochemical Biosynthesis Pathways Lead to Understanding of Gene-Enzyme Relationship Biosynthesis of Arginine Ornithinetranscarbamylase Argininosuccinate lyase Argininosuccinate synthetase Acetylornithinase N-acetylornithine Ornithine Citrulline argininosuccinate arginine aspartate carbamyl phosphate Beadle & Tatum undertook the identification of mutations that blocked the synthesis of several vitamins & amino acids

  3. Mutagenesis Screen Identifies Link Between Genetic Element and Enzyme Mutagen Figure 14.24Raven & Johnson, Biology 5th Ed

  4. Individual Mutants Blocked at Distinct Enzymatic Steps in Arg Biosynthesis Pathway

  5. What is a Gene • A gene is a contiguous region of DNA that is transcribed • The transcript (that which is transcribed) is an RNA molecule • There are 3 types of genes & 3 types of RNA transcribed • rRNA encoding genes  rRNA (class I) • protein encoding genes  mRNA (class II) • tRNA encoding genes  tRNA (class III) • In eukaryotic cells, each class of RNA is transcribed by a different RNA polymerase

  6. Decoding The Coding Problem • 1959-60 – F Crick, S Brenner, F Jacob, M Meselson, J Monod • Messenger Hypothesis • RNA serves as intermediate btwn DNA & protein synthesis • Ribosomes associated with protein synthesis • Heterogeneous RNA (hnRNA) found w/ & w/o ribosomes • Is hnRNA or rRNA the messenger? • Brenner, Jacob & Meselson did a 1 week experiment that proved hnRNA was the message – renamed mRNA

  7. DNA, RNA, and the Flow of Information Replication Transcription Translation • F. Crick coined phrase central dogma • DNA codes for RNA. RNA codes for protein. • How is expression of gene controlled? • How does information get from the nucleus to the cytoplasm? • What is relationship btwn DNA nucleotide sequence & protein amino acid sequence?

  8. Gene Expression: From Gene to Protein

  9. Decoding The Coding Problem • Crick proposed the Adaptor Hypothesis • intermediate btwn mRNA & protein synthesis • intermediate adapt (bind) to mRNA & “decode” the message • What is nature of genetic code? • 1 to 1 • 2 to 1 • 3 to 1 • 4 to 1 • Nature of the adaptor? • tRNA –necessary for translation • tRNAs w/ amino acids attached • Aminoacylated tRNA (aa tRNA)

  10. DNA, RNA, and the Flow of Information: The Central Dogma • Gene expression • The production of an ultimate gene product (RNA &/or protein) • The expression of a gene takes place in two steps: • Transcription – production of a single-stranded RNA copy of a segment of DNA • Translation – production of a protein from mRNA • Gene product is therefore • rRNA or tRNA or protein (via mRNA)

  11. Review of RNA • RNA differs from DNA • single stranded • ribose • uracil • RNA can exist in a double-stranded complex with either DNA, with itself, or with another RNA strand • mRNA – encodes proteins • rRNA – main constituent of ribosomes • tRNA – transfer amino acids to ribosome and decode mRNA • snRNA – splicing • snoRNA – RNA modifications • 7SL RNA – co-tranlational translocation for secretion • siRNA – regulation of transcription & translation

  12. Transcription: DNA-Directed RNA Synthesis • Requirements: • A DNA template • ribonucleoside triphosphates (ATP, GTP, CTP, and UTP) • RNA polymerase • Regulated process • transcription factors • DNA sequences recognized by RNA pol & txn facs

  13. Gene Structure 3’ 5’ 3’ 5’ txn initiation site 5’ coding strand 3’ template strand 3’ 5’ promoter coding region • The DNA template • Strand nomenclature • For different genes in the same DNA molecule, the roles of the strands may be reversed top, coding, sense bottom, template, antisense

  14. Transcription: DNA-Directed RNA Synthesis • Initiation • RNA polymerase binds to the promoter region Coding

  15. Transcription: DNA-Directed RNA Synthesis • Elongation • RNA polymerase unwinds the DNA and synthesizes RNA • Nucleotides added at 3’ end of growing RNA strand • 5¢3¢ • Template and RNA transcript are antiparallel

  16. Transcription: DNA-Directed RNA Synthesis • Termination • RNA polymerase reaches DNA sequences at end of gene that cause it to stop and release the RNA and DNA

  17. Transcription – Prok v Euk • Prokaryotic transcription occurs ___________ • Eukaryotic transcription occurs ____________ • Prokaryotic cells have ___________ RNA polymerase • Eukaryotic cells have ____________ RNA polymerases

  18. The Genetic Code • The genetic code relates nucleotide sequence of genes (DNA/mRNA) to the amino acid sequence of proteins • What is the nucleotide-amino acid correspondence? • A degenerate code • Frames • How many nucleotides correspond to an amino acid? • Three • A triplet code

  19. The Genetic Codebreakers • 1960-65 M Nirenberg, G Khorana, P Leder • Identified which nucleotide sequences specified which amino acids

  20. The Genetic Code • A codon was determined to be 3 adjacent nucleotides • Code is degenerate • Multiple codons specify same amino acid • Each of these codons is NOT recognized by a different tRNA • “wobble” in the base-pairing btwn tRNA anticodon w/ mRNA codon

  21. The Genetic Code

  22. Anticodons & Wobble RNA-RNA bp rules A-U G-C G-U Modified bases Inosine (I) I-A I-U I-C 5’-codon-3’ / 3’-αcodon-5’

  23. The Genetic Code • How is the code read? • 3letterwordsallruntogetherwhatspunctuation?

  24. Translation: Reading Frames AAGCUAGCAUGUGGAUGCAUGAUCGCUACAAUCGAGGAUC a: AAG CUA GCA UGU GGA UGC AUG AUC GCU ACA AUC GAG GAU C b: A AGC UAG CAU GUG GAU GCA UGA UCG CUA CAA UCG AGG AUC c: AA GCU AGC AUG UGG AUG CAU GAU CGC UAC AAU CGA GGA UC Lys Leu Ala Cys Gly Cys Met Ile Ala Thr Ile Glu Asp Ser stop His Val Asp Ala stop Ser Leu Gln Ser Arg Ile Ala Ser Met Trp Met His Asp Arg Tyr Asn Arg Gly

  25. Putative Translation of cDNA Sequence

  26. Translation - tRNA • tRNA has three functions: • carries amino acid • base-pairs with mRNA • interacts with ribosomes • tRNAs must read mRNA correctly to assure proper protein sequence • tRNAs must carry the correct amino acids

  27. Translation - tRNA • Intramolecular base pairing defines 2 structure

  28. Charging a tRNA Molecule Amino acids attached to correct tRNAs by aminoacyl-tRNA synthetases aminoacyl-tRNA synthetase aa-tRNA Phe-tRNAPhe

  29. Translation – Ribosomes • 2 subunits: Large & Small • Eukaryotes • Large – 60S – 28S, 5.8S & 5S rRNA + ~45 proteins • Small – 40S – 18S rRNA + ~ 33 proteins • Ribosome – 80S • Prokaryotic • Large – 50S – 23S & 5S rRNA + ~ 40 proteins • Small – 30S – 16S rRNA + ~ 28 proteins • Ribosome – 70S

  30. Ribosomes

  31. Electron Density Model of Ribosome & tRNAs

  32. Translation - Ribosome • A site – aa-tRNA binding site • P site - tRNA with peptide chain • E site – exit site empty tRNA briefly sits after translocation

  33. TranslationInitiation • Involves initiation factors to help ribosome & Met-tRNAiMet bind • Initiator tRNA enters P-site

  34. TranslationElongation • Elongation factors • aa-tRNA binding • Translocation • Peptidyl transferase • Ribozyme activity of large subunit aa-tRNA entry Peptidyl transferase Termination Translocation

  35. TranslationElongation

  36. Polysomes

  37. Regulation of Translation • Antibiotics • defensive molecules produced by fungi & bacteria, against other microbes • Molecular modality • synthesis of cell walls, inhibiting transcription, inhibiting translation • erythromycin • streptomycin • tetracycline • Because of differences between prokaryotic and eukaryotic ribosomes, the human ribosomes are usually unaffected.

  38. Posttranslational Events • Folding • Glycosylation • Phosphorylation • Acylation • Proteolytic processing • Dimerization/multimerization

  39. Postranslational Events • Subcellular location of translation and ultimate protein localization & modification

  40. Figure 12.15 A Signal Sequence Moves a Polypeptide into the ER (Part 1)

  41. Figure 12.15 A Signal Sequence Moves a Polypeptide into the ER (Part 2)

  42. Point Mutations AUGUGGCUCCCGAUUAA C T coding ATGTGGCTCCCGATTAA ATGTGGCTCCTGATTAA AUGUGGCUCCUGAUUAA

  43. Point Mutations AUGUGGCUCCCGAUUAA coding ATGTGGCTCCCGATTAA ATGTGGCTCCCGTTTAA AUGUGGCUCCCGUUUAA

  44. Point Mutations ATGTGGCTCCCGATTAA coding ATGTAGGCTCCCGATTAA

  45. Point Mutations coding ATGTGGACTCCCGATTAA ATGTGGCTCCCGATTAA

  46. Tautomeric Shifts Alter Base-Pairing Specificity Keto-enol & amino-imino tautomerization

  47. Mutations Arise from Chemical Changes in Bases Deamination Alkylation

More Related