Teaching Biology Through Bioinformatics

1. Teaching Biology Through Bioinformatics Real world genomics research in your classroom

2. Bioinformatics • Use of computers to analyze genomic data for molecular biology research • basic biological research • medical research • clinical medicine application • taxonomy

3. Bioinformatics is a great way to learn biology • Using computers to study primary biological data (genomes, proteins, other databases) • students learn biology as a dynamic process of interpreting complex data • students can reproduce current scientific work & ask new questions • science is no longer just a collection of facts in a textbook, it’s a process of inquiry

4. Teaching Biology with Bioinformatics • Bioinformatics tools lead directly to insights about genes, proteins, evolution • “Hey! Most human genes have more bases of introns than they do exons.” • “Hemoglobin sequences show that seals are closer to weasels than they are to whales.” • “Protein shapes determine their function, so small changes can make a big difference.”

5. All you need… • Students can work on bioinformatics questions at low cost • only need Internet connected computers • most database tools are free on Internet • unlimited data • GenBank, protein structures, mutations, microarrays, etc. • teacher knowledge & “comfort” • questions to answer

6. What we offer… • Teaching modules • inquiry labs • student & teacher lab handouts • supporting teaching resources • PowerPoint presentations • Supplemental skills modules • Download from Web site • http://bio.kimunity.com

7. Modules in development • Testing for Sickle Cell Anemia • develop a genetic diagnostic test to screen for disease • Endosymbiosis • evolutionary history mitochondria & chloroplasts • Hemophilia Gene Therapy • build a vector and insert correct gene • Are Seals and Whales Related? • studying evolutionary relationships

8. Using Bioinformatics in Medicine Sickle Cell Anemia & the Hemoglobin Gene

9. Sickle Cell Anemia • Most common genetic disease in US • high incidence in African-Americans • affects red blood cell structure & function • single base mutation causing single amino acid change • SNP = single nucleotide polymorphism

10. Symptoms • Anemia • jaundice, fatigue, paleness, shortness of breath • Hypoxia (low oxygen) & capillary damage • severe pain in organs & joints • retinal damage (blindness) • Delayed growth • delayed puberty, stunted growth • Infections • more susceptible • depressed immune • death from bacterial infections • Stroke • blocked small blood vessels in brain • primarily in children

11. Sickle cell hemoglobin mutant hemoglobin (Hb S)

13. Cell biology • Hb S molecules stick together • form fibers • under low blood oxygen levels • deoxyhemoglobin sickles • distortion of cells from normal round to sickle shape

14. HbAA Hb A Hb S Hb A HbAS HbAS HbSS Hb S Genetics • Sickle cell mutation • Hb S • changes 6th amino acid of  hemoglobin chain • normal glutamic acid  valine • Recessive allele • heterozygote • Hb AS, normal, but carrier • homozygote recessive • Hb SS, sickle cell disease • 2 sickle cell carriers mate… • each child has 1/4 chance of having the disease

15. Prevalence in U.S. • Carriers • ~2 million Americans carry sickle cell trait • 1 in 14 African-Americans • Disease • ~72,000 Americans have disease • ~1 in every 700 African-American babies born in U.S. has sickle cell disease

16. The Malaria Connection • Sickle cell disease is surprisingly common for a potentially lethal genetic disease • Heterozygote advantage • heterozygotes are tolerant of malaria infection & do not suffer symptoms of sickle cell disease

17. Malaria

18. Prevalence of Malaria Prevalence of SickleCell Anemia ~sickle cell movie~

19. Public health • Many carriers of this mutant allele are not aware that they have it • at risk of having children with the disease • DNA test for sickle cell allele would benefit public health • genetic counseling • pre-natal testing

20. Your Assignment • Develop a simple inexpensive DNA test for sickle cell allele • develop DNA probe • test for presence of sickle cell mutation • use bioinformatics tools • online databases of DNA sequences • UCSC Genome Browser • probe design tool • Primer3

21. DNA review • DNA double helix • A–T, C–G • base pair bonds can be broken by heating to 100°C • separate strands • denature, or melt

22. DNA probes • Probe • short, single stranded DNA molecule • mix with denatured DNA • DNA Hybridization • probe bonds to complementary DNA sequence • Label • probe is labeled for easy detection labeled probe G A T C A G T A G genomic DNA C T A G T C A T C 5’ 3’

23. G A T C C G T A G Designing Probes • Allele specific probes • probes require matched sequences • can detect single base differences in alleles • single mis-matched base near middle of probe greatly reduces hybridization efficiency labeled probe genomic DNA X C T A G T C A T C 5’ 3’

24. Dot blot • Genomic DNA • denature DNA • bind DNA from cells on filter paper • DNA hybridization • wash probe over filter paper • if complementary sequence present, probe binds to genomic DNA • expose on X-ray film • dark spots show bound probe

25. Get hemoglobin sequence • UCSC Genome Browser • human genome database • http://genome.ucsc.edu/ • UCSC Genome Browser home page • click on link to Genome Browser • in genome pulldown menu, choose “Human” • for position text box, type “HBB” (hemoglobin ) • hit “submit”

26. Genome Browser Results • Listing of genes & sequences in database • Click on “RefSeq” gene for HBB (NM_000518)

27. Chromosome view • Position of HBB in genome • at base 5.2 million on chromosome 11

28. Change view of chromosome • Move & zoom tools • zoom out ~30x to see more of chromosome 11

29. More Hb genes • Cluster of hemoglobin genes on chromosome 11 • HBD, HBG1, HBG2 & HBE1 • what are these genes?

30. Get the DNA sequence • Click on the HBB RefSeq gene • HBB RefSeq summary page

31. HBB RefSeq gene summary page • Click on “Genomic Sequence from assembly”

32. Formatting the sequence • Sequence Formatting Options • “exons in upper case, everything else in lower case” • hit “submit” • Genomic DNA • lower case = introns • spliced out of mRNA before translation • upper case = exons • translated into polypeptide chain

33. HBB DNA sequence >hg16_refGene_NM_000518 range=chr11:5211005-5212610 5'pad=0 3'pad=0 revComp=TRUE ACATTTGCTTCTGACACAACTGTGTTCACTAGCAACCTCAAACAGACACC ATGGTGCATCTGACTCCTGAGGAGAAGTCTGCCGTTACTGCCCTGTGGGG CAAGGTGAACGTGGATGAAGTTGGTGGTGAGGCCCTGGGCAGgttggtat caaggttacaagacaggtttaaggagaccaatagaaactgggcatgtgga gacagagaagactcttgggtttctgataggcactgactctctctgcctat tggtctattttcccacccttagGCTGCTGGTGGTCTACCCTTGGACCCAG AGGTTCTTTGAGTCCTTTGGGGATCTGTCCACTCCTGATGCTGTTATGGG CAACCCTAAGGTGAAGGCTCATGGCAAGAAAGTGCTCGGTGCCTTTAGTG ATGGCCTGGCTCACCTGGACAACCTCAAGGGCACCTTTGCCACACTGAGT GAGCTGCACTGTGACAAGCTGCACGTGGATCCTGAGAACTTCAGGgtgag tctatgggacgcttgatgttttctttccccttcttttctatggttaagtt catgtcataggaaggggataagtaacagggtacagtttagaatgggaaac agacgaatgattgcatcagtgtggaagtctcaggatcgttttagtttctt ttatttgctgttcataacaattgttttcttttgtttaattcttgctttct ttttttttcttctccgcaatttttactattatacttaatgccttaacatt gtgtataacaaaaggaaatatctctgagatacattaagtaacttaaaaaa aaactttacacagtctgcctagtacattactatttggaatatatgtgtgc ttatttgcatattcataatctccctactttattttcttttatttttaatt gatacataatcattatacatatttatgggttaaagtgtaatgttttaata tgtgtacacatattgaccaaatcagggtaattttgcatttgtaattttaa aaaatgctttcttcttttaatatacttttttgtttatcttatttctaata ctttccctaatctctttctttcagggcaataatgatacaatgtatcatgc ctctttgcaccattctaaagaataacagtgataatttctgggttaaggca atagcaatatctctgcatataaatatttctgcatataaattgtaactgat • first 50 bases are untranslated “leader” sequence • actual protein coding sequence starts at base 51 • starting with letters ATG

34. Get the mutant sequence • Sickle cell mutation • single base mutation • 6th amino acid: glutamic acid  valine • need DNA sequence to design probe • SNPs • single nucleotide polymorphisms • “variations and repeats” section: pack

35. SNPs of HBB gene • several SNPs of HBB gene • need mutation in exon • near beginning of HBB protein • rs334 = Hb S mutation

36. rs334 Hb S sickle cell mutation • “Sequence in Assembly” = normal sequence • “Alternate Sequence” = sickle cell sequence

37. Align Hb A & Hb S sequences • Line up sequences • sequence fragment is enough to design DNA probes for normal & mutant sequences Normal: catggtgcacctgactcctgAggagaagtctgccgttactg HBB: ATGGTGCATCTGACTCCTGAGGAGAAGTCTGCCGTTACTGCCCTGTGGGG Mutant:catggtgcacctgactcctgTggagaagtctgccgttactg

38. Designing the probe • Primer3 • free on Web from MIT http://frodo.wi.mit.edu/cgi-bin/primer3/primer3_www.cgi • powerful tool for primer design • paste in sequence fragment

39. Allele specific probes • Need 2 probes • normal allele probe • sickle cell allele probe • choose hybridization probes • Customize probes • 12-16 bases • 40°-60°C longer probes are stable at higher temperatures

40. Your probes… • Ready to order! • Place an order at your local DNA lab!

41. Extra credit Advanced Assignments

42. Advanced Assignment #1 • Use the Web to research other “allele specific” genotyping methods • ligase chain reaction • primer extension • TaqMan • Design probes for one of these alternate technologies

43. Advanced Assignment #2 • PCR & Restriction Digest • pre-natal testing • for small samples it is necessary to use PCR to amplify the amount of genomic DNA before testing • once you have a PCR-amplified DNA fragment of a gene, a restriction enzyme may be able to distinguish between alleles • design PCR primers & find restriction enzyme that will locate sickle cell allele • design with Primer3

44. Restriction enzymes • NEBcutter • http://tools.neb.com/NEBcutter2 • New England BioLabs • screens DNA sequence against all restriction enzymes • Webcutter • similar program • http://www.firstmarket.com/cutter/cut2.html

45. NEBcutter

46. Advanced Assignment #3 • Population genetics • determine if sickle cell allele is in Hardy-Weinberg equilibrium in the U.S. African-American population • ~2 million Americans carry sickle cell trait • 1 in 14 African-Americans is a carrier • ~1 in every 700 African-American babies born in U.S. has sickle cell disease