1 / 8

Genetic Variation

Genetic Variation. Most genes have small sequence differences between individuals Occur every 1350 bp on average Some of these polymorphisms may affect: How well the protein works How the protein interacts with another protein or substrate

ivo
Download Presentation

Genetic Variation

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript


  1. GeneticVariation • Most genes have small sequence differences between individuals • Occur every 1350 bp on average • Some of these polymorphisms may affect: • How well the protein works • How the protein interacts with another protein or substrate • The different gene forms containing polymorphisms are called alleles

  2. Between-population variation Salamanders

  3. Within-population variation: Hawaiian Happy-face spiders, Theridion grallator

  4. RestrictionFragmentLengthPolymorphismRFLPAnalysis • Some genetic polymorphisms can be identified by the presence or absence of a specific restriction endonuclease recognition site:For example: GAATTC versus GATTTC • RFLP analysis is the detection of the change in the length of the restriction fragments as a result of these mutations.

  5. EcoR1 EcoR1 TTCGTCGAATTCGTTATGCGAATTCTGCATAATGGTC TTCGTCGAATTCGTTATGCTAATTCTGCATAATGGTC EcoR1

  6. Paternity Testing

  7. Criminal cases

More Related