1 / 7

Yang, Srikanth and Maliha

Project Proposal: Cloning and expression of the thermostable neutral protease of B.Stearothermophilus. Yang, Srikanth and Maliha. Bacillus Stearothermophilus. Genus - Bacillus or Geobacillus Species - strearothermophilus Gram +ve , Spore Forming

izzy
Download Presentation

Yang, Srikanth and Maliha

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript

  1. Project Proposal:Cloning and expression of the thermostable neutral protease of B.Stearothermophilus Yang, Srikanthand Maliha

  2. Bacillus Stearothermophilus • Genus - Bacillus or Geobacillus • Species - strearothermophilus • Gram +ve , Spore Forming • Grow in a temperature range of 45-75oC • Widely distributed in soil, hot springs, ocean sediment, and is a cause of spoilage in food products

  3. GOI : nprT • Accession # M11446.1 • Consists of 1881 bp, 548 aa • Responsible for the production of thermostable neutral protease. • Industrially significant. • No introns & Restriction sites

  4. Process flow:

  5. PCR 5’ATGAACAAACGGGCGATGC 3’ 5’ATGAACAAACGGGCGATGCTCGGGGCGATCGGGCTGGCGTTCTTCGGCGAAGGGGGAATCGATCGTCTGGAACG…………………………………………TACTATTTGACGCCGACGTCGAACTTCGTGCCGCCTGCGTGCAAGCGGCCGCTGATTTGTACGGGTCGACAAGCCAAGAAGTCAACTCGGTGAAACAGGCGTTCAATGCGGTTGGAGTGTATTAA3’ 3’ GTTACGCCAACC TCACATAATT 5’

  6. Biobrick Construction Promoters : • BBa_K360041 : Minimum Blue Light Receptor Promoter • BBa_K258005 : Oxygen promoter-Vitreoscilla hemoglobin(VHb) promoter in E. coli. • BBa_K118011 : PcstA (glucose-repressible promoter) Transformation to competent E.Coli and Expression of gene Detection of Thermostable neutral Protease enzyme

  7. Thank you

More Related