1 / 6

Your Inner Fish by Neil Shubin Chapter 10: Ears

Your Inner Fish by Neil Shubin Chapter 10: Ears. Zoë Steier. Structure of the Ear. Pinna: flap of external ear unique to mammals. Evolution of Ear Bones in Mammals. 1 st gill arch: Malleus Incus 2 nd gill arch Stapes. Functions of the Ear. Hearing Balance Acceleration.

jerry-houston
Download Presentation

Your Inner Fish by Neil Shubin Chapter 10: Ears

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript

  1. Your Inner Fish by Neil ShubinChapter 10: Ears Zoë Steier

  2. Structure of the Ear • Pinna: flap of external ear unique to mammals

  3. Evolution of Ear Bones in Mammals • 1st gill arch: • Malleus • Incus • 2nd gill arch • Stapes

  4. Functions of the Ear • Hearing • Balance • Acceleration

  5. Homo sapiens PAX2 gene ctttccttttttgttctcctgtttgtcctctgacccagcccattcttctcctgtgttaacttccaggttccccttattattatagtgccgccccccggtccgcccctgccgctcgtgccgctgcctatgaccgccactagttaccgcggggaccacatcaagcttcaggccgacagcttcggcctccacatcgtccccgtctgaccccaccccggaggagggaggaccgacgcgacgcatgcctcccggccaccgccccagcctcaccccatcccacgacccccgcaacccttcacatcacccccctcgaaggtcggacaggacgggtggagccgcggggcgggaccctcaggcccgggcccaccgcccccagccccgcctgccgcccctccccgcctgcctggactgcgcggcgccgtgagggggattcggcccagctcgtcccggcctccaccaagccagccccgaagcccgccagccaccctgccgtactcgggcgcgacctgctggtgcgcgccggatgtttctgtgacacacaatcagcgcggaccgcagcgcggcccagccccgggcacccgcctcggacgctcgggcgccaggagcttcgctggaggggctgggccaaggagattaagaagaaaacgactttctgcaggaggaagagcccgctgccgaatccctgggaaaaattcttttcccccagtgccagccggactgccctcgccttccgggtgtgccctgtcccagaagatggaatgggggtgtgggggtccggctctaggaacgggctttgggggcgtcaggtctttccaaggttgggacccaaggatcggggggcccagcagcccgcaccgatcgagccggactctcggctcttcactgctcctcctggcctgcctagttccccagggcccggcacctcctgctgcgagacccggctctcagccctgccttgcccctacctcagcgtctcttccacctgctggcctcccagtttccc

  6. Bibliography • Shubin, Neil. Your Inner Fish: A Journey Into the 3.5-Billion Year History of the Human Body. New York: Vintage Books, 2009. • “Teaching Tools.” Your Inner Fish: A Journey Into the 3.5-Billion Year History of the Human Body. University of Chicago. 2009. <http://tiktaalik.uchicago.edu/book-tools.html>. • “Blastn”. Basic Local Alignment Search Tool. National Center for Biotechnology Information. 2010. <http://blast.ncbi.nlm.nih.gov/Blast.cgi>.

More Related