small beads, big reads

1. small beads, big reads Jay Shendure Church Lab 12-08-03

2. DNA SEQUENCING • Sanger Sequencing (state-of-the-art): • ~ 0.1 cents per unfinished base • ~ $50,000,000 per 16x human genome coverage • ~ 1 million bases per machine per day (~ 12 bases per second) • But Personalized Genomics Requires… • ~ 0.000002 cents per unfinished base • ~ $1,000 per 16x human genome coverage • ~ 10 billion bases per instrument per day (~ 120,000 bases per second)

3. Short Term Aims • Sequence several E. Coli strains • 4.6 mbp genome • Resequencing, not de novo !! • 11x coverage = ~50 million bases per slide • Sequence several mammalian mRNA-tag libraries • 2 mllion tags per library • 25 bp per tag = ~50 million bases per slide

4. POLONY FISSEQ(Mitra et al. 2003)

5. Strategy Overview (for short-term aims) • Generate flanked library with purely in vitro methods. (Nick) • Generate 1-micron “clonal beads” via emulsion PCR. (Greg) • FACS-sort amplified beads from “empty” beads. (Jun) • Sequence acrylamide-immoblized beads in parallel via FISSEQ protocol. (Jay)

6. (1) In Vitro Library Construction Strategy (Nick) • Shear & size-select genomic DNA to 200 bp fragments • Ligate 100-bp “forward” linker & 200-bp “reverse” linker • Size-select 500 bp fragments Unique segment Universal primer sequences

7. (2)Clonal PCR Amplification with Emulsions (Greg) • Protocol adopted from Dressman et al. (PNAS 2003) • Sub-picoliter aqueous compartments => isolated reaction chambers • Compartments also contain paramagnetic beads to which PCR products end up immoblized (via biotin-streptavidin interaction). • All copies of amplified DNA on same bead are the same, but amplified DNA on different beads is different (AMPLIFIED CLONALITY, just like polonies!) • ~100 million beads per PCR tube!!!

8. (3)FACS Sorting of Amplified vs. Empty Beads (Jun) • Poisson statistics limit the fraction of compartments that have a single template amplified and immoblized on a single bead. • FACS sorting permits rapid enrichment for beads bearing PCR products of clonally amplified template.

9. (4)Prepare for Sequencing… • Immobilize millions (to billions?) of beads in 6% acrylamide gel. • Denature second strand and hybridize Cy3-labeled universal sequencing primer adjacent to unique region of amplified templates. • Sequence in parallel as per a modified version of the standard FISSEQ protocol (with Cy5-SS-dNTPs)

10. Fluorescent In Situ Sequencing (FISSEQ)

11. Strategy Overview (for short-term goals) • Generate flanked library with purely in vitro methods. (Nick) • Generate 1-micron “clonal beads” via emulsion PCR. (Greg) • FACS-sort amplified beads from “empty” beads. (Jun) • Sequence acrylamide-immoblized beads in parallel via FISSEQ protocol. (Jay)

12. Clonal Amplification via Emulsion Based PCR • Library template = ~112-mer with 24 unique bases. • Generated via oligonuclotide “wobble” in synthesis. • Unique sequence alternates between C/A and G/T. • Library complexity of ~1.7 million. • Tube PCR in oil-aqueous emulsion. • Primer-loaded 1-micron beads (~100 million per tube) • Dilute template concentration. • Beads recovered and poured into polyacrylamide gel. • Sequence of 3rd base determined • Cy5-SS-dATP vs. Cy3-SS-dCTP

17. Clonal Amplification via Emulsion Based PCR • ~11,235 beads present on this frame. • ~96 have strong Cy3 signal. • ~46 have strong Cy5 signal. • ~3 have both strong Cy5 and Cy3 signal. • ~1% of beads are clonal. 99% are “empty”. • ~100 million beads => ~1 million useable beads (per PCR tube)

18. Emulsion PCR Optimization • Amplified Bead => ~31% of signal of “loaded” bead. • 2x template => 46% signal drop • 4x dNTPs, MgCl2 => 72% signal boost • 30 cycles -> 50 cycles => 72% signal boost

19. Strategy Overview (for short-term goals) • Generate flanked library with purely in vitro methods. (Nick) • Generate 1-micron “clonal beads” via emulsion PCR. (Greg) • FACS-sort amplified beads from “empty” beads. (Jun) • Sequence acrylamide-immoblized beads in parallel via FISSEQ protocol. (Jay)

20. Best Sequencing Experiment To Date • 3 uM beads, each loaded with 1 of 5 templates • Beads are immoblized in 6% acrylamide (no trapping!) • Hybridize universal sequencing primer and begin cycles. • Sequencing primer is Cy3 labeled • 28 FISSEQ quarter-cycles (C-A-G-T-C-A-G-T…) • Image Analysis of ~250 brightest beads in MATLAB

21. Sequencing Quarter-Cycle (30 minutes + scan-time) • Klenow Buffer Equilibration 1 minute • Single Base Extension 4 minutes • Wash 5 minutes • Scan (variable) • TCEP Cleavage 5 minutes • Wash 5 minutes • Wash 5 minutes • Wash 5 minutes (lots of room for temporal optimization, process automation)

22. FISSEQ(C..A..G..T) x 7 = 28 quarter-cycles T1 CACACACACACACACTCCACCA T2 GTGTGTGTGTGTGTGTCCACCA T3 AGTGCTCACACACGTGATCCAC T4 CAGCCGAACGACCGATCCACCA T5 ATGTGAGAGCTGTCGTCCACCA

23. Scanning Setup • Only captured single frame per cycle (~ 0.5 mm2) • 10x Objective (~0.5 pixels per micron) • 1600 x 1200 pixels (8-bit), ~1 to 2 second exposures • 21 pixels per 3-micron bead used in image analysis • Installation of XY motor stage system (happening today) will instantly increase throughput 1000-fold. • Plan is to switch to 20x objective (for 1 micron beads)

24. Image Analysis (MATLAB) • Align images • Select beads to process • Sum Cy5 and Cy3 bead-intensities over 21-pixel areas • Normalize by Cy5 values by corresponding Cy3 values • Apply manually-set thresholds • Derive sequences for each bead from signature patterns of “add” vs. “no-add” at each cycle • Compare sequence signatures to known template sequences to determine accuracy.

25. Image Alignment y x

26. y x

27. y x

28. Sum Signal for Cy5 and Cy3 for Each Bead at Each CycleNormalize by Cy5 (on base) by Cy3 (on primer) 0 1 1 1 0 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 0 1 1 1 0

29. Cy5 Cy3

30. y x

31. y x

32. y x

33. y x

34. y x

35. y x

36. y x

37. y x

38. y x

39. Templates Beads Cycle Number ->

40. Summary of Results • 252 sequencing reads • 3,495 bases sequenced • Read lengths of 13-16 bases • Library complexity = 5 • 72 unique bases @ mean-fold-coverage of ~48

41. Normalized Sequencing Error Analysis

42. Normalized Sequencing Error Analysis Templates Cycle Number ->

43. Speculation on Sources of Error • (1) Signal-to-noise decay • (2) Progressive dephasing • (3) Cumulative misincorporation events • (4) Local “slippage” mispriming • All of the above? • Error is probably “local” in nature. Cy5 Cy3 T1 CACACACACACACACTCCACCA T2 GTGTGTGTGTGTGTGTCCACCA T3 AGTGCTCACACACGTGATCCAC T4 CAGCCGAACGACCGATCCACCA T5 ATGTGAGAGCTGTCGTCCACCA

44. How much room for rapid improvement? • 50e6 / 3495 => 14306-fold improvement is required. • (21*252)/(1200*1600) => 0.2% of area in frame is utilized. • One frame = 0.5 mm2 => 0.02% of full slide surface. • 10,000-fold improvement will be straight-forward. • Frame utilization -> 2% (higher bead density, better software) • Slide utilization -> 10% (XY motor on stage) • Boosting read-length by requisite 50% might be trickier.

45. The Homopolymer Issue • Resequencing and tag-sequencing DOES NOT require that this problem be perfectly solved, provided: (a) Reads can be confidently matched to unique locations or identities. (b) Small differences cause reproducible changes to sequencing traces. Cy5 Cy3

46. How much read-length is needed? (E. coli)

47. How much read-length is needed? (Agencourt LongSage)

48. How many beads can we sequence on one slide? (present-day) 30,000 beads per frame => 30 million beads per slide

49. How many beads can we sequence on one slide? (at the extreme) Mitra Lab Self-organizing-monolayer 1 micron beads MAX = ~2 billion per slide

50. AUTOMATION [GP & Jim Horn] GRUNT I GRUNT II