Pharmacogenomics and Personalized Medicine: an Education and Implementation Perspective

1. Pharmacogenomics and Personalized Medicine: an Education and Implementation Perspective Michael D. Kane, PhD (1) Associate Professor of Bioinformatics, Department of Computer & Information Technology, College of Technology (2) University Faculty Scholar, Purdue University (3) Lead Genomic Scientist, Bindley Bioscience Center at Discovery Park, Purdue University (4) Visiting Research Scientist, College of Pharmacy, Ohio Northern University. Purdue University West Lafayette, Indiana, USA bioinformatics.tech.purdue.edu

2. OUTLINE: Background Course Development & Delivery Research Projects Vision Statement Conclusion

3. Background Ph.D. from Purdue University - School of Pharmacy; Molecular Pharmacology Industry Experience; Scientist: Pfizer, Inc., R&D in Genomics Vice President: Genomic Solutions, Inc., R&D (Oligo, ArrayIQ) Co-founder and President: Nucleico, LLC, (Spanscript, SURFER) Co-founder and CSO: Genomic Guidance, LLC Co-founder and Consultant: BATS, Inc. Academic Experience; Primary appointment; Dept. of Computer and Information Technology, Purdue University Lead Genomic Scientist, Bindley Bioscience Center at Discovery Park, Purdue University Visiting Research Scientist, College of Pharmacy, Ohio Northern University Adjunct Professor, Biology, Eastern Michigan University Other; Expert Witness, DNA Forensics

4. Course Development and Delivery Purdue University Biomedical Informatics (upper undergrad course, 3 cr. hrs.) Examination of computational life sciences and health informatics, where computing students apply their skills. Bioinformatics Computing and Systems Integration (grad course, 3 cr. hrs.) Hands-on cluster computing course, students utilize both VM and blade systems to build clusters, install OS and scientific software, assess and improve system performance.

5. Course Development and Delivery • Purdue University • Genomic Technologies (grad, 1 cr. hr., for the CLS AOS*) • Discovery Information Systems (grad, 1 cr. hr., for the CLS AOS*) • Biomedical Systems Architectures (grad, 1 cr. hr., for the CLS AOS*) • Biomedical Systems Analysis and Design (grad, 1 cr. hr., CLS AOS*) • Introduction to Computational Life Sciences (undergrad, 1 cr. hr.) • Co-developed w/ Purdue Colleagues; • Quantitative Research Methods (grad, 3 cr. hrs.) • Research Seminar Series in Technology (grad, 1 cr. hr.) • Introduction to Electric Vehicle Technology (undergrad, 3 cr. hrs.) • Electric Vehicle Systems (grad, 3 cr. hrs.) • *CLS AOS; Computational Life Sciences Area of Specialization, these courses were created in support of this inter- departmental, interdisciplinary program providing bioinformatics training for MS and PhD graduate students.

6. Course Development and Delivery • Ohio Northern University, College of Pharmacy • 2011-2012 Visiting Research Scientist (Academic Sabbatical), Department of • Pharmaceutical and Biomedical Sciences, College of Pharmacy, • Ohio Northern University, Ada, Ohio. • 1997-Present Adjunct Professor of Pharmacology, Department of Pharmaceutical • and Biomedical Sciences, College of Pharmacy, Ohio Northern • University, Ada, Ohio. • Provide instruction each semester in the areas of • the genetic and molecular basis of neurological diseases, • (2) the pathophysiology and treatment of Alzheimer’s disease, • (3) genomics and personalized medicine.

7. Course Development and Delivery Dublin Institute of Technology 2010, Summer Visiting Faculty Member, School of Manufacturing and Design Engineering, Dublin, Ireland. Developed and delivered a 4-week graduate course entitled “Clinical and Non-Clinical Applications of Genomic Screening Technologies”. Patent Application: Kane, M.D., Duffy, P., Applegate, B., Savakhin, S., Walsh, P., and Woods, G. One-Step DNA Detection System (2011).

8. Research Projects: Environmental Toxicology Development of Tools for Environmental Assessment and Real-Time Sensing of Contaminants (Showalter Trust) 1. Johns, S.M., Denslow, N.D., Kane, M.D., Watanabe, K.H., Orlando, E.F., and Sepúlveda, M.S. Effects of estrogens and antiestrogens on gene expression of fathead minnow (Pimephales promelas) early life stages. Environmental Toxicology 26(2): 195-206, 2011. 2. Johns, S.M., Kane, M.D., Denslow, N.D., Watanabe, K.H., Orlando, E.F., Villeneuve, D.L., Ankley, G.T. and Sepúlveda, M.S. Characterization of Ontogenetic Changes in Gene Expression in the Fathead Minnow (Pimephales promelas). Environmental Toxicology and Chemistry 28(4): 873-880, 2009. 3. Kane, M.D., Springer, J.A., Iannotti, N.V., Gough, E.S., Johns, S.M., Schlueter, S.D. and Sepulveda, M.S. Identification of Development and Tissue-Specific Gene Expression in the Fathead Minnow Pimephales promelas, Rafinesque using Computational and DNA Microarray Methods. Journal of Fish Biology 72, 2341-2353, 2008.

9. Research Projects: Pathogen Detection Center for Food Safety Engineering: Developing Biosensors to Detect Foodborne Microbial and Chemical Hazards (USDA) Development of Tools for Environmental Assessment and Real-Time Sensing of Contaminants (Showalter Trust) 1. Kim, H., Kane, M.D., Kim, S., Dominguez, W., Applegate, B.M, and Savikhin, S. A Molecular Beacon DNA Microarray System for Rapid Detection of E. coli O157:H7 that Eliminates False Signal Risk. Biosensors and Bioelectronics 15:1041-1047, 2007. 2. Perry, L., Heard, P., Kane, M., Kim, H., Savikhin, S., Dominguez, W., Applegate, B. Application of multiplex PCR to the detection of pathogens in food. Journal of Rapid Methods and Automation in Microbiology 15: 176-198, 2007.

10. Research Projects: Personalized Medicine An Interactive Software System for Integrating Clinical Genotyping with Prescription Drug Safety Assurance. (Microsoft Research) 1. Springer, J.A., Iannotti, N.V., Sprague, J.E., and Kane, M.D. Construction of a drug safety assurance information system based on clinical genotyping. ISRN Bioinformatics. (982737, 9 pages), 2012. 2. Springer, J.A., Iannotti, N.V., Kane, M.D., Haynes, K., and Sprague, J.E. Teaching drug safety and pharmacogenomics: a practicum learning environment enabled by a dedicated personalized medicine instructional software system. American Journal of Pharmaceutical Education, 75(2):32-34, 2010. 3. Likovich, M., Derr, A., Kisor, D.F, Kane, M.D., and Sprague, J.E. Personalized Medicine and the Future of Pharmacy Practice. Pharmacy Times April, 2010. 4. Sprague, J.E., Sullivan, D.L., and Kane, M.D. Personalized Medicine: Pharmacogenetics as a Method for Improving Patient Outcomes. Ohio Pharmacist 57(11): 13-18, 2008. 5. Kane, M.D., Springer, J.A., and Sprague, J.E. Drug Safety Assurance through Clinical Genotyping: Near-Term Considerations for a System-Wide Implementation of Personalized Medicine. Personalized Medicine 5(4): 387-397, 2008. 6. Kane, M.D. and Summers, K.H. Challenges and opportunities in pharmacogenomics and therapeutics. Journal of Managed Care Pharmacy 13(7): 607-608, 2007. (Patent application) Kane, M.D., Springer, J.A., Sprague, J.E., and Iannotti, N.V. Method for Utilizing Patient Genotyping for Drug Safety. 61/031,527 (2008).

11. Research Projects: Personalized Medicine (Key Issues) Genetic Variance: Single Nucleotide Polymorphisms (SNPs) are differences in the DNA. They represent 90% of all human genetic variations. Genetically similar to a mutation, but distinct in that a SNP is not causal to a clinical disease or disorder. Genetic Inheritance: The appearance of deleterious mutations during evolution tend to NOT be inherited for obvious reasons (those that affect growth, reproduction and viability). Our modern existence is the result of millions of years of tolerated (and occasionally beneficial) changes in our genome, which is most often evident in what natural products we can and cannot eat or consume (evolutionary pressure & natural selection). Natural Products vs. Modern Pharmaceuticals: Differences in our genome and our response to these compounds Natural Selection vs. Modern Life Span: We are the 10th generation of humans on earth with an average life span >40 years old! Personalized Medicine involves understanding how some genetic markers impact drug safety and efficacy, and PREDICTING how a patient will respond to a specific drug/dose (based on the patient’s genetic profile). For the healthcare consumer, most of these genetic differences have an effect on (1) drug metabolism (pharmacokinetics) or (2) drug action (pharmacodynamics).

12. Research Projects: Personalized Medicine • Adverse Drug Reactions • More than 770,000 patients die or sustain serious injury every year in the U.S. from Adverse Drug Reactions (ADRs). • ADRs are the 5th leading cause of death in the United States and are one of the leading, preventable public health issues today. • In terms of total health care dollars, ADRs cost the U.S. health care system between $1.5 and $5.4 billion per year. • It is estimated that human genetic variation (SNPs) have been account for approximately 30% of all ADRs. • 1 in 5 people in the US harbor a SNP that alters the drug metabolism or drug activity of at least one FDA approved drug.

13. Pharmacogenomics and Personalized Medicine EXAMPLE: Warfarin (Coumadin): Anticoagulation. If you are prescribed WARFARIN, you have a condition that may generate potentially life-threatening blood clots. If you are dosed with too much WARFARIN you could experience serious complications due to internal bleeding, yet if you are dosed with too little WARFARIN you may be in danger of serious consequences associated with circulating emboli due to excessive blot clotting. Warfarin Drug Action (circulator system) Vitamin K Epoxide Reductase Complex 1 (VKORC1) Inhibitor Warfarin Metabolism (hepatic) CYP2C9 to 6-hydroxywarfain

14. Pharmacogenomics and Personalized Medicine • GENESCRIPTION was developed as an educational tool that models the FUTURE of applied personalized medicine. • The online portal models a drug dispensing environment (pharmacist) where the user is presented with a patient that has: • DNA screened to identify any SNPs related to drug safety and efficacy. • Prescribed a drug that is affected by a SNP related to drug safety and efficacy. • Provides predictive information regarding the safety and efficacy of the prescribed drug in the patient. www.genescription.com Genescription is a free, online instructional utility available to the public, and can be accessed and utilized by anyone with an internet connection.

15. Dosing curve of a 10 mg oral dose in a “normal” metabolizer From: www.genescription.com

16. Dosing curve of a 10 mg oral dose in a “poor” metabolizer From: www.genescription.com

17. Dosing curve of a 10 mg oral dose of Warfarin in a “poor” metabolizer From: www.genescription.com

18. Dosing curve of a 10 mg oral dose of Warfarin in a VKORC1-SNP Patient From: www.genescription.com

19. NH2 Palindromic Sequence Research Projects: One-Step DNA Detector CATTTCCCGTGGTTGCTTGCGTTTGAGACTGGAAATG Kane, M.D., Duffy, P., Applegate, B., Savakhin, S., Walsh, P., and Woods, G. One-Step DNA Detection System (2011). (Patent Application)

20. Research Projects: One-Step DNA Detector From: Kim, H., Kane, M.D., Kim, S., Dominguez, W., Applegate, B.M, and Savikhin, S. A Molecular Beacon DNA Microarray System for Rapid Detection of E. coli O157:H7 that Eliminates False Signal Risk. Biosensors and Bioelectronics 15:1041-1047, 2007

21. Vision for Success in Higher Education Programmatic Goals

22. Vision for Success in Higher Education Challenges:Opportunities: Uncertain Economics Diversify Sources of Revenue Uncertain Career Path Inclusive Curriculum Value of Curricular Skills Establish and Leverage Active Partnerships (School of Medicine, Nursing, Pharma, Biotech, etc.) Develop and Leverage Resources Industrial Advisory Board Student-Facilitated Recruiting Alumni Association IU Research and Technology Commercialization Corp. Inter-Institutional Collaborations Online Education Programs

23. Thank You!