Molecular Epidemiology: Impact on Food Regulation and Future Needs

1. Molecular Epidemiology:Impact on Food Regulation and Future Needs Bala Swaminathan, Ph.D. Vice-President, IHRC, Inc. Atlanta, GA, USA

2. Epidemiology • Epidemiology: the study of the distribution and determinants of health-related states in specified populations, and the application of this study to control health problems. • Epidemiologists • collect data about an entire population through surveillance systems or descriptive epidemiological studies. • use these data to generate hypotheses about the relationships between exposure and disease. • test the hypotheses by conducting analytical studies such as cohort or case-control studies. • use the findings from these studies to develop, recommend and/or implement some form of community intervention to end the health problem and prevent its recurrence.

3. Molecular Biology • Molecular biology involves the study of macromolecules (DNA, RNA, proteins) and the macromolecular mechanisms found in living things, such as the molecular nature of the gene and its mechanisms of gene replication, mutation, and expression. • In the context of infectious disease epidemiology, the molecular biologic approach involves molecular characterization of disease –causing organisms and their subdivision by their DNA, RNA and/or proteins. • DNA “fingerprinting” • Subtyping • Molecular subtyping

4. Molecular Epidemiology = Epidemiology of disease in affected population + Molecular Characterization (subtyping) of Etiologic Agent Synergy between two seemingly disparate scientific disciplines

5. Example of Molecular Subtyping PulseNet Universal Reference Standard Fragment Size 1135 Kb 452.7 Kb 216.9 Kb 76.8 Kb 33.3 Kb A typical E. coli O157:H7 PFGE Gel

6. National network of public health laboratories • State and local public health departments and Federal agencies (CDC, USDA-FSIS, FDA) • Routinely perform standardized molecular subtyping of foodborne disease-causing bacteria • Share DNA “fingerprints” electronically in real-time via Internet • Dynamic database of DNA “fingerprints” at CDC

8. Participation in PulseNet International 33 13 13

9. 22 20 18 16 14 12 No. of cases 10 8 6 4 2 Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec Month E. Coli O157 Outbreak – Minnesota, 2000 Courtesy: John Besser, MN State Health Dept

10. Statistical Association with Consumption of Hamburger from Cub Foods; 2000 22 22 20 20 18 18 16 16 14 14 12 12 No. of cases No. of cases 10 10 8 8 6 6 4 4 2 2 Nov Dec Nov Dec Without PFGE OR = 1.93; p = 0.31 With PFGE OR = 17.1; p = 0.005 -NOT significant- -SIGNIFICANT- Courtesy: John Besser, MN State Health Dept

11. Odds of exposure given illness 1 in 200 Criminal investigation: Outbreak investigation: Courtesy: John Besser, Minnesota Dept. of Health

12. What are the Standards of Evidence for Molecular Epidemiology? • Strong epidemiologic association between illness in outbreak-related cases and implicated food • Pathogen isolated from implicated food • Pathogen isolates subtyped validated methods • Pathogen subtyping data corroborate epidemiologic findings (case patient isolates are indistinguishable/nearly indistinguishable from implicated food isolates) • If subtyping data do not corroborate epidemiologic findings, appropriate and acceptable explanation of discrepancy

13. E. coli O157 Outbreak 0609mlEXH-2 No. entries in The PulseNet database before 8/15/2006 N= 22,532 157 (0.7%) 594 (2.6%) Extra band at approx. 145Kb EXHX01.0124 EXHX01.0047 For outbreak detection, must use stringent criteria to define subtype of outbreak strain unless epidemiologic findings indicate the need more inclusive criteria

14. Multistate outbreak PulseNet begins subtyping Listeria Impact of Molecular Epidemiology on Food Regulation Incidence of reported cases and outbreaks of listeriosis in the United States, 1986-2002* Single state outbreak *Data from active surveillance systems, Some data are preliminary

15. Impact of Molecular Epidemiology on Food Regulatory Policy – Recent Example • Recent outbreaks involving frozen processed foods that are not fully-cooked but require microwave cooking or conventional cooking before consumption. • Largest of these outbreaks spanned a period of more than one year, and caused illness in more than 400 people in 41 states. • Vehicle of transmission in this outbreak frozen pot pies containing poultry meat • Pathogen was Salmonella serotype Typhimurium or a monophasic variant of the same serotype . • Two other salmonellosis outbreaks detected and investigated in Minnesota between 2005 and 2006. • Frozen, pre-browned, single-serving, microwavable stuffed-chicken entrees were involved in both outbreaks. • Between 1998 and 2005, Minnesota had detected two more outbreaks caused by similar products • Common features of all outbreaks • Molecular epidemiology enabled public health authorities to recognize and promptly investigate the outbreaks • Posting of the outbreak pattern on the national PulseNet database served as the trigger for other states to look for cases in their own states • although the packages of the products implicated in these outbreaks had cooking instructions which, if strictly followed, may have inactivated the Salmonella, the presentation and packaging of the product may have led the consumer to assume that they were fully cooked and, therefore, only needed to be heated to an appropriate temperature for consumption. Remedies: Better labeling and Consumer Education

16. 1993 Western States E. coli O157 Outbreak 726 cases 4 deaths outbreak detected 1993 Meat recall 39 d CL PHL: 0-7 d outbreak detected 2002 PHL: 4-7 d 18 d Public Health Impact of Molecular Epidemiology • If only 5 cases of E. coli O157:H7 infections were averted by the recall of ground beef • in the Colorado outbreak, the PulseNet system would have recovered all costs for • start up and operation for 5 years. (Elbasha et al. Emerg. Infect. Dis. 6:293-297, 2000)

17. Largest U.S. Food Recalls (> 750,000 lbs) in which Molecular Epidemiology Has Played a Prominent Role Total = 513,950,000 lbs other recent notable outbreaks:

18. Molecular Epidemiology: Further Improvements Needed • Reduce delays in pathogen subtyping and submission of patterns to national databases • Implement more discriminating and epidemiologically relevant subtyping methods to complement or replace existing methods; PFGE will continue to be used for the next few years • Reduce/eliminate disparities in state/local capacities for molecular epidemiology of foodborne diseases • Develop/implement innovative strategies for timely and routine gathering of epidemiologic data independently and in parallel with molecular subtyping • “Team Diarrhea” concept works; Can the “Team Diarrhea” approach be replicated in other states, regionally or nationally?

19. Next Generation Subtyping Methods for Molecular Epidemiology • MLVA typing • Already in use for E. coli O157:H7 subtyping in PulseNet • SNP (single nucleotide polymorphism) analysis • Under development and evaluation • Whole genome sequencing • On the horizon

20. Isolate A Isolate B Isolate C Isolate D Multilocus VNTR Analysis(MLVA) • Variable Number Tandem Repeats (VNTRs) in non-coding sequences • Conserved repeat motif found in the genome • Example: TAACCG • Variable numbers of repeat units among isolates of the same species • MLVA examines the number of repeats at multiple loci to determine genetic relationships Number of repeats 1 2 4 5 TAACCG TAACCGTAACCG TAACCGTAACCGTAACCGTAACCG TAACCGTAACCGTAACCGTAACCGTAACCG

21. Insertion Deletion Variable Number Tandem RepeatsVNTRs

22. Multiple Locus VNTR Analysis can bedeveloped from low-pass sequence data

23. Clustering of outbreak isolates and some selected sporadic isolates by MLVA GA water park outbreak CT apple cider outbreak CO outbreak NJ outbreak Western States outbreak WI restaurant outbreak NY County Fair MI outbreak

24. Manning, et al. (2008)