Welcome to the world of two Arabidopsis genes:

1. Welcome to the world of two Arabidopsis genes: At4g14770 and At3g22760 At4g14770 and At3g22760 Presented by: Matt Emmer HC70AL Spring 2006

2. At4g14770 and At3g22760: Tesmin/TSO1-like CXC Domain Proteins • TSO1 • involved in cellular expansion and cytokinesis, as well as in the development of ovules and microspores • Contains two cysteine-rich regions similar to CXC domains involved in chromosome segregation • Tesmin • a member of the CXC family, and a testis-specific protein

3. Structure of At4g14770 (1st Line)

4. Structure of At3g22760 (2nd Line) ?

5. Where is At4g14770 Expressed?

6. Where is At3g22760 Expressed?

7. 9 Homozygous Mutants Identified in First Line 1 Heterozygous Mutant Were there Mutants in the 1st Line? WT Mut

8. What were the DNA Concentrations? Plant Concentration Plant Concentration Plant 3 5 ng/μL Plant 15 2 ng/μL Expected Size Plant 4 15 ng/μL Plant 16 4 ng/μL Wild Type 1,624 bp Plant 10 4 ng/μL Plant 18 2 ng/μL T-DNA 1,095 bp Plant 12 1.5 ng/μL Wild Type 0.5 ng/μL Plant 13 4.5 ng/μL Were there Mutants in the 2nd Line? No Mutants

9. Genotyping with separate primers

11. Seeds and Silique

12. Embryos

13. Mutantvs.Wild Type Mutant Wild Type Any Difference? NO

14. 1918 + 1319 = 3237 What’s Upstream of At4g14770? 1918 bp 3237 bp 1319 bp I-proof Pcr Ecori Digest Single EcoRI Site in Upstream Region

15. Upstream Bioinformatics Primers Eco RI Site

16. Only a single mismatch in the SP6 sequencing data How accurate was the SP6 and T7 Sequencing Data? Actual Sequence:AAAGTAACGGACATCAGTTTTTTTTTTCTTTTCCCTTTTTTCTCTTTTTTG

17. What’s Upstream of At3g22760? 2911 bp I-proof Pcr Ecori Digest

18. Did the T-DNA insert actually knock out At4g14770?

19. Did the T-DNA insert actually knock out At4g14770? • Two Possibilities: • Intron was spliced out • T-DNA was not spliced out, resulting in a longer mRNA strand • Follow up experiment:

20. Conclusions • 1st Line mutants were attained • No mutant phenotype observed • Evidence to suggest that gene knockout was not successful • Limited information obtained for 2nd line • No mutant plants attained • SALK indicates a T-DNA insert is in 5’ UTR, so gene may not have been knocked out • Future Experiments • Double/Triple Knock Outs to overcome duplication: • At4g14770, At3g22760, At3g22780

21. The TA’s Mike Gaviño Ria Yagnik Jonathan Russell Acknowledgements Big Shots To Be • Tomokazu Kawashima • Brandon Le • Jessica Luke The Big Shots • Dr. Bob Goldberg • Dr. Anhthu Bui • Dr. Xingjun Wang HC70AL Jordan, Thi, Jennifer, Brian, Jordan, Jason, Daisy, Bekah, and Heather