1 / 1

T  RI (AY497473)

A. T  RI (AY497473). E1. E2. E3B. E3. E4. E5. E6. E7. E8. E9. 3`-UTR. Pseudogene on chromosome 19, AC010503 (join 118179..117967, 117642..117467, 116129..116055, 116021..115960). AluSX. AluSB. AluSX. L1PA13. AluSX. E2. E3. E3. E4. E4. Ctrl PC-3 LNCaP hPCPs. B.

kayo
Download Presentation

T  RI (AY497473)

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript


  1. A TRI (AY497473) E1 E2 E3B E3 E4 E5 E6 E7 E8 E9 3`-UTR Pseudogene on chromosome 19, AC010503 (join 118179..117967, 117642..117467, 116129..116055, 116021..115960) AluSX AluSB AluSX L1PA13 AluSX E2 E3 E3 E4 E4 Ctrl PC-3 LNCaP hPCPs B 300 bp 288 bp TRIB TRI 178 bp TRIB C EC Kinase TM 5`-GAACTTCCAACTGgtaag.....aggccctttttcagTAAAGTCATCACCTGGCCTC-3` EXON 2 INTRON 2 EXON 3B EXON 3 TRIB, alternative exon GAACTTCCAACTACTGgccctttttcagTAAAGTCATCACCTGGCCTC hs TRIB (AJ619019) GAACTCCCAACTACAGgacctttttcagAAAAGCAGTCAGCTGGCCTT mm TRIB (NM_009370) GAACTCCCAACTACAGgacctttttcagAAAAGCAGTCAGCTGGCCTC rn TRIB (NM_012775) GAACTCCCAACTGTTGgtccttttccagGAAAGCCACCATCTGGCCTT ss TRIB (NM_001038639) GAACTCCCAACTACAGgacctttttcagAAAAGCAGTCAGCTGGCCTC cf TRIB (AY455799) E L P T T G P F S V K S S P G L hs TRIB (AJ619019) E L P T T G P F S E K Q S A G L mm TRIB (NM_009370) E L P T T G P F S E K Q S A G L rn TRIB (NM_012775) E L P T V G P F PG K PPS G L ss TRIB (NM_001038639) E L P T T G P F S E K Q S A G L cf TRIB (AY455799) TRI, exon2/3 junction GAACTTCCAACTACTGTAAAGTCATCACCTGGCCTC hs TRI (NM_004612) GAACTCCCAACTACAGAAAAGCAGTCAGCTGGCCTT mm TRI (D25540) GAACTCCCAACTACAGAAAAGCAGTCAGCTGGCCTC rn TRI (S81584) GAACTCCCAACTGTTGGAAAGCCACCATCTGGCCTT ss TRIB (DQ519380) E L P T T V K S S P G L hs TRI (NM_004612) E L P T T E K Q S A G L mm TRI (D25540) E L P T T E K Q S A G L rn TRIB (NM_012775) E L P T VG K PPS G L ss TRIB (DQ519380)

More Related