1 / 1

5’GCGTTGATCGTAATTAATTTGGGATGTGTAGTGGGGCTGTTCCCTACAATTGATGGTAGA3’

5’GCGTTGATCGTAATTAATTTGGGATGTGTAGTGGGGCTGTTCCCTACAATTGATGGTAGA3’ What is the complementary strand of DNA? 3’CGCAACTAGCATTAATTAAACCCTACACATCACCCCGACAAGGATGTTAACTACCATCT5’ Which is strand is the template strand, which one is the coding strand? 5’  3’ coding; 3’  5’ template

kezia
Download Presentation

5’GCGTTGATCGTAATTAATTTGGGATGTGTAGTGGGGCTGTTCCCTACAATTGATGGTAGA3’

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript


  1. 5’GCGTTGATCGTAATTAATTTGGGATGTGTAGTGGGGCTGTTCCCTACAATTGATGGTAGA3’5’GCGTTGATCGTAATTAATTTGGGATGTGTAGTGGGGCTGTTCCCTACAATTGATGGTAGA3’ • What is the complementary strand of DNA? • 3’CGCAACTAGCATTAATTAAACCCTACACATCACCCCGACAAGGATGTTAACTACCATCT5’ • Which is strand is the template strand, which one is the coding strand? • 5’ 3’ coding; 3’  5’ template • Box the promoter region. What’s the purpose of the promoter region? • 5’GCGTTGATCGTAATTAATTTGGGATGTGTAGTGGGGCTGTTCCCTACAATTGATGGTAGA3’ • Where RNA polfirst binds to and unwinds DNA • Transcribe this segment. • 5’ UAAUUAAUUUGGGAUAUG-UGU-AGU-GGG-GCU-GUU-CCC-UAC-AAU-UGA-UGG-UAGA3’ • Translate the mRNA • Met – Cys – Ser – Gly – Ala – Val – Pro – Tyr – Asn • What if we have the following mutations: • 5’GCGTTGATCGTAATTAATTTGGGATGTGCAGTGGGGCTGTTCCCTACAATTGATGGTAGA3’ – what type of mutation is it? (Show the polypeptide chain.) • 5’ UAAUUAAUUUGGGAUAUGUGCAGUGGGGCUGUUCCCUACAAUUGAUGGUAGA3’ • Met – Cys – Ser – Gly – Ala – Val – Pro – Tyr – Asn (silent mutation) • 5’GCGTTGATCGTAATTAATTTGGGATGTGTAGAGGGGCTGTTCCCTACAATTGATGGTAGA3’ what type of mutation is it? (Show the polypeptide chain.) - 5’ UAAUUAAUUUGGGAUAUGUGUAGAGGGGCUGUUCCCUACAAUUGAUGGUAGA3’ • Met – Cys – Arg – Gly – Ala – Val – Pro – Tyr – Asn (missense mutation) • 5’GCGTTGATCGTAATTAATTTGGGATGTGTAGTGGGGCTGTTCCCTAAAATTGATGGTAGA3’ what type of mutation is it? (Show the polypeptide chain.) • 5’ UAAUUAAUUUGGGAUAUGUGUAGUGGGGCUGUUCCCUAAAAUUGAUGGUAGA3’ • Met – Cys – Ser – Gly – Ala – Val – Pro (non sense mutation) • 5’GCGTTGATCGTAATTAATTTGGGATGTGTACGTGGGGCTGTTCCCTACAATTGATGGTAGA3’ what type of mutation is it? (Show the polypeptide chain.) • 5’ UAAUUAAUUUGGGAUAUG-UGU-ACG-UGG-GGC-UGU-UCC-CUA-CAA-UUG-AUG-GUA-GA • Base insertion (Frame shift) • Met – cys- thr – trp- gly-cys-

More Related