From DNA to Protein

1. From DNA to Protein Transcription and Translation

2. Genes • Genes: are segments of DNA that code for proteins • Most nucleotide base sequences in DNA don’t code for anything • ATGCGAATCGTAGCATACGATGCATGCACGTGCATGCTTTTAGCAGCATGCAGCATGCAGCTATACGATAGCTAGCTAGCTCGATGCATGCATCGATGCTAGCATGCTAGCTAGCATGCATGCATGCACGTTATCGTTAAATTTTTCTTGGGTTAATTGGG

3. Transcription • Is the process that opens up a gene coding portion of DNA and makes a copy (transcript) of the base sequences to go on and make a protein • Transcription can be broken down into 3 simple steps

4. Transcription Step 1 • The process of transcription begins as the enzymes (helicase) unzip the DNA in the region of the gene that will be copied (transcribed)

5. Transcription Step 2 • RNA Polymerase binds to the DNA and begins forming base pairs with the complementary bases of DNA • The transcript of DNA it makes is called mRNA

6. mRNA • Is a segment of copied DNA that codes for a protein • mRNA has 3 differences with DNA • 1. mRNA’s sugar is ribose • 2. mRNA’s is single stranded • 3. mRNA doesn’t have thymine (T) as a base pair, instead is has Uracil • SO… G still binds to C • But.. A binds to U in mRNA

7. Practice • So RNA polymerase matches the correct bases from the DNA, let’s practice RNA polymerase’s job • IF DNA had this nucleotide sequence, what sequence will the mRNA have? • ATTGCCTTGGAATCCGTCA---DNA • UAACGGAACCUUAGGCACU---mRNA

8. Transcription Step 3 • The mRNA stand breaks away from the DNA and leaves the nucleus of the cell and enters the cytoplasm • The DNA strands rejoin each other

9. In total • Transcription makes a copy of nucleotide bases from DNA that serve as a code for making proteins • So the code is written in a sequence of bases • Proteins are long chains of Amino Acids • So the code of a protein is the sequence of aminoacids • Translation from bases to amino acids is the next step to building a protein

10. Gentic Code • How does the mRNA base sequence code for the 20 common amino acids it needs to build a protein? • Each set of 3 bases in a row codes for differing amino acids, a set of 3 is called a codon • Each codon codes for differing amino acids

11. The Genetic Code • All sequences start with AUG

12. Translation • Recall that ribosomes are found in both the nucleus and cytoplasm, and they are responsible for making protiens • mRNA that has been transcribed is moved out of the nucleus to the cytoplasm where a ribosome will bind to it and begin making a protein from the mRNA code

13. Translation • Can be broken down into 5 simples steps

14. Translation step 1 • Ribosome attaches to the mRNA strand in the cytoplasm • Molecules of tRNA, each carrying a specific amino acid, approach

15. tRNA • Is a specialize strand of RNA that binds to a specific amino acid and also has a anticodon region that complements a mRNA strand to attach the correct amino acid to make a protein • So if the mRNA has the codon GCU the anticodon in tRNA will be CGA

16. Translation step 2 • The start Codon AUG, which codes for the amino acid methionine, is found on the mRNA strand • A tRNA carrying methionine attaches to the ribosome and mRNA strand

17. Translation step 3 • A tRNA molecule matching the next codon in the mRNA comes in and binds to the ribosome and mRNA • The methionine and the new amino acid just brought in attach to each other via a peptide bond

18. Translation step 4 • After the peptide bond is formed, the ribosome slides along the mRNA strand to the next codon • The first tRNA is released (no longer carrying the amio acid methionine) • A new tRNA comes in a brings the correct amino acid

19. Translation step 5 • The process continues to repeat, forming a chain of amino acids, until a stop codon is reached • Then the ribosome releases the new protein, which can now fold and become functional