1 / 2

Quiz#10 LC710 10/27/10 name___________

Quiz#10 LC710 10/27/10 name___________. Given the following transgenes co-existing in the same animal. rtta binds DNA if Dox is present. CMVp. rtta I.R.E.S GFP. tetO. TATA. RFP. Q1 0.5 pt (circle one) :. Q2 0.5 pt (circle one) :. Cellular Fluorescence observed

kineks
Download Presentation

Quiz#10 LC710 10/27/10 name___________

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript

  1. Quiz#10 LC710 10/27/10 name___________ Given the following transgenes co-existing in the same animal. rtta binds DNA if Dox is present CMVp rtta I.R.E.S GFP tetO TATA RFP Q1 0.5 pt (circle one) : Q2 0.5 pt (circle one) : Cellular Fluorescence observed prior to addition of Doxycycline is: Red Green Both Neither Cellular Fluorescence observed after addition of Doxycycline is: Red Green Both Neither Q3: 1pt What does tta do in the absence of Dox?________________________ What does tta do in the presence of Dox?________________________

  2. Given the following transgenes co-existing in the same animal. 4 8 3 Pax6p 12 7 2 CreERt2 I.R.E.S GFP 11 6 1 10 5 Hox1p 9 loxP-RFP-loxP-TOXIN Above are WT cells in the brain expressing Pax6 and/or Hox1. If expressed, TOXIN will Kill cells (disappear) Q4 (2pts) Q5 (2pts) Prior to addition of TAM, which Cells are: After TAM addition, which Cells are: Red only: Green only: Both: Neither: Red only: Green only: Both: Neither: TAM= TAMOXIFEN Q6 (2pts) : in the above transgene, loxP sites are in this orientation: = loxP sequence ATAACTTCGTATAATGTATGCTATACGAAGTTAT This experiment is actually poorly designed and the loxP sites need to oriented as follows: Hox1p Why?

More Related