Ghosh Lab University of Arizona Department of Chemistry

1. Cloning 101: A Primer Ghosh Lab University of Arizona Department of Chemistry

2. Outline • Cloning overview • pDRAW32 • Design • Gene • Insert • Primers • Further considerations (optimization of the process) • Transformation

3. Cloning Overview • Four main steps in cloning: • Insert synthesis • Restriction enzyme digest • Ligation • Transformation Insert (your gene) + Functional construct Plasmid (vector)

4. Design Overview • Steps to follow in designing your cloning experiment: • Design your gene • Design your insert • Pick your enzymes • Check your design • Recheck your design Functional construct

5. pDRAW32 Plasmid maps: pDRAW32 All of the important information in one place!

6. pDRAW32 • You can look at the sequence in detail • Open reading frames • Translation • Restriction sites • Complementary strand

7. Design of the Gene If you are cloning out of a known plasmid, just use the sequence that you have Example, the gene we want: G C D R A S P Y C G We got this from phage display: ggctgcgacagggcgagcccgtactgcggt G C D R A S P Y C G Phage sequence Final sequence for the gene of interest: ggctgcgacagggcgagcccgtactgcggttaa G C D R A S P Y C G * Add a stop codon

8. Design of the Gene • If you are designing the gene from scratch, keep in mind codon usage • Not all codons are created equal • Un-optimized codons could lead to lower expression levels • The codon usage reflects levels of tRNA available in E. Coli • Pay attention to the stop codons too (XL1-Blues read through TAG {amber stop codon} 20% of the time)

9. What if we don’t have the DNA sequence? Design from scratch! (don’t forget about codon usage) or preferably… http://www.bioinformatics.org/sms2/rev_trans.html http://www.entelechon.com/index.php?id=tools/backtranslation&lang=eng

10. Choice of Restriction Sites/Enzymes Once you have your gene, you need to design a way to get it into your plasmid • Endonucleases (or restriction enzymes) are enzymes which cut DNA at specific internal recognition sequences • Compare to exonucleases, which cut from one end • You must choose restriction sites that are available in the plasmid you are cloning into • They must not appear in your gene (silent mutation can remove unwanted sites in your designed gene)

11. Really Important Factors to Remember When Choosing Restriction Enzymes • Restriction sites must exist only once in your plasmid • They must be in the correct position relative to the purification tag • Restrictions sites usually add extra residues to your gene product; make sure they are compatible with your peptide/protein • Some restriction sites are sub-optimal for cloning • Blunt end sites • dam and dcm methylation-affected enzymes

12. Blunt vs Sticky Ends AGCCAG AATTCGTCGAC GATCCTGGCT GTCGACG Most common restriction enzymes “sticky ends” GATCCGGGCTGCAAGCGGTTAAG Digestion AATTCTTAACCGCTTCCAGCCCG AGCCAG GATCCGGGCTGCAAGCGGTTAAGAATTCGTCGAC + GTCGACGAATTCTTAACCGCTTCCAGCCCG GATCCTGGCT • “Sticky ends”: 5’ or 3’ over-hangs that allow the DNA to anneal even though it is not covalently bound • Help with the next step: ligation Digestion ATCGGGCTGCAAGCGGTTAACAG AGCCAGAT ATCGGGCTGCAAGCGGTTAACAG CTGGTCGAC CTGTTAACCGCTTCCAGCCCGAT GTCGACCAG CTGTTAACCGCTTCCAGCCCGAT ATCTGGCT + AGCCAGAT CTGGTCGAC Blunt-end restriction enzymes ATCTGGCT GTCGACCAG No sticky ends

13. dam Methylation Dam methylase • Dam methylase puts a methyl group on the nitrogen of 6th position of adenosine at the site: GATC • All of the E. Coli that we use generate DNA with dam methylation • Some enzymes only cut dam methylated DNA: eg DpnI • Some enzymes do not cut dam methylated DNA: eg XbaI http://www.neb.com/nebecomm/tech_reference/restriction_enzymes/dam_dcm_methylases_of_ecoli.asp

14. dcm Methylation Dcm methylase • Dcm methylase puts a methyl group on the carbon of 5th position of cytidine at the site: CCAGG and CCTGG • The enzyme we use most that can be affected by dcm methylation is SfiI • XL1-Blues and BL21s are both Dcm+ http://www.neb.com/nebecomm/tech_reference/restriction_enzymes/dam_dcm_methylases_of_ecoli.asp

15. Design of the Insert • Once you have your restriction enzymes chosen, it is time to design the final complete gene • The multiple cloning site (or whatever plasmid you are cloning into) should already have the 5’ portion of the gene intact (i.e. RBS, spacer, Met) • Sequences must be in frame NcoI BtgI 51 CTTTAATAAG GAGATATACC ATGGGCAGCA GCCATCACCA TCATCACCAC M G S S H H H H H H SacI AscI SbfI SalI NotI BamHI EcoRI EcoICRI BssHII PstI AccI HindIII 101AGCCAGGATCCGAATTCGAG CTCGGCGCGC CTGCAGGTCG ACAAGCTTGC S Q D P N S S S A R L Q V D K L A

16. Design of the Insert Multiple cloning site 71 ATGGGCAGCAGCCATCACCATCATCACCAC M G S S H H H H H H SacI AscI SbfI SalI BamHI EcoRI EcoICRI PstI AccI HindIII 101AGCCAGGATCCGAATTCGAGCTCGGCGCGCCTGCAGGTCGACAAGCTTGC S Q D P N S S S A R L Q V D K L A The gene we want: ggctgcgacagggcgagcccgtactgcggttaa G C D R A S P Y C G * Be aware of the amber stop codon: TAG BamHIPstI AGCCAGGATCCGAATTCGAGCTCGGCGCGCCTGCAGGTCGACAAGCTTGC S Q D P N S S S A R L Q V D K L A G C D R A S P Y C G * ggctgcgacagggcgagcccgtactgcggttaa AGCCAGGATCCGggctgcgacagggcgagcccgtactgcggttaaCTGCAGGTCGACAA

17. Design of the Insert Always check and re-check your sequence! ATGGGCAGCA GCCATCACCA TCATCACCAC AGCCAGGATCCGggctgcgacagggcgagcccgtactgcggttaaCTGCAGGTCGACAA Translate the whole gene atgggcagcagccatcaccatcatcaccacagccaggatccgggctgcgacagggcgagc M G S S H H H H H H S Q D PG C D R A Sccgtactgcggttaactgcaggtcgacaa P Y C G -L Q V D Everything looks good: in frame the whole way!

18. Design of the Insert The wrong way to do it: AGCCAGGATCC ggctgcgacagggcgagcccgtactgcggttaaCTGCAGGTCGACAAGCTT The gene is just inserted after the restriction site, which is out of frame with the plasmid-encoded start-codon/His-tag atgggcagcagccatcaccatcatcaccacagccaggatccggctgcgacagggcgagcc M G S S H H H H H H S QD PA A T G R Acgtactgcggttaactgcaggtcgacaagctt R T A V N C R S T S Frame shifted = garbage! **Some plasmids, for whatever reason, have restriction sites out of frame with the translated gene**

19. Finishing Touches • Restriction enzymes need 5’ and 3’ base pairs to cut properly • NEB has a reference guide for specific enzymes (see link below) • A good rule of thumb is 6 base pairs after the recognition site • Inserting a GC “clamp” at the end and beginning of the sequence is also a good idea atgggcagcagccatcaccatcatcaccacagccaggatccgggctgcgacagggcgagc M G S S H H H H H H S Q D PG C D R A Sccgtactgcggttaactgcaggtcgacaa P Y C G -L Q V D Final gene, polished and ready to go: gccagccaggatccgggctgcgacagggcgagcccgtactgcggttaactgcaggtcgacgc S QD PG C D R A S P Y C G -L QV D http://www.neb.com/nebecomm/tech_reference/restriction_enzymes/cleavage_linearized_vector.asp

20. Design of the Primers Once the insert is designed correctly, the next step is designing primers to order from IDT, based on insert synthesis strategy • Three main strategies towards insert synthesis: • PCR amplification • Klenow extension of overlapping primers • Complimentary full-length primers + Insert Vector

21. PCR Amplification of Insert from an Existing Gene • The most common method of insert synthesis • Necessitates a pre-existing construct • Extra restriction sites and/or amino acid residues can be added on each side of the gene • Internal mutations are more difficult Insert

22. PCR Synthesis of Insert • PCR amplification from overlapping primers • No pre-existing construct is needed • PCR products messy, possibly making subsequent rxns difficult • Good for inserts >150 bp F1: 10x 5’ 3’ F2: 1x 5’ 3’ 5’ 3’ R1: 1x 3’ 5’ R2: 10x Insert Full-length insert should still be the major product

23. 5’ 3’ 5’ 3’ Klenow Klenow Extension of Overlapping Primers • Two primers that are complimentary in their 3’ region are designed (overlap  15bp) • Extended to full length by the Klenow fragment of DNA Polymerase I • Useful if insert is 50 to 150 bp 5’ 3’ 5’ 3’ Insert Klenow fragment: retains 3’ to 5’ polymerase activity, but does not have exonuclease activity

24. Complimentary Full-Length Primers • The simplest approach • Order two primers that compliment each other • Mix the two primers, heat, and aneal slowly (to ensure proper base-pairing) • Feasible if the total insert size is < 60 bp Anneal 3’ 5’ Insert 3’ 5’

25. Designing Primers to Order Once the insert synthesis technique is decided, primer design is fairly straight-forward • Forward primers: • Assess necessary overlap and copy the sequence from your designed gene, along with extra 5’ sequence • Reverse primers: • First, design exactly as if it were a forward primer: Copy necessary overlap and extra 3’ sequence from your designed gene • Once all this is in place, use pDRAW32 sequence manipulator to calculate the reverse compliment • Order the pDRAW32 calculated sequence directly

26. Cloning Out an Existing Gene Forward Primer: Design of Reverse Primer: gccagccaggatccgggctgcgacagg ccgtactgcggttaactgcaggtcgacgc In the example mentioned previously, we would normally use full length overlapping primers, but let’s look at the more common case of having a preexisting gene: Preexisting gene: Overlap tgcggcccagccggccatgggctgcgacagggcgagcccgtactgcggtggaggcggtgctgcagcgc A A Q P A M G C D R A S P Y C G G G G A A A + Goal gene: gccagccaggatccgggctgcgacagggcgagcccgtactgcggttaactgcaggtcgacgc S QD PG C D R A S P Y C G -L QV D Extra sequence from gene design

27. Ordering Primers Now we can order the primers: http://www.idtdna.com/Home/Home.aspx gccagccaggatccgggctgcgacagggcgagcccgtactgcggttaactgcaggtcgacgc S Q D P G C D R A S P Y C G - L Q V D Forward primer to order: gccagccaggatccgggctgcgacagg Design of Reverse Primer: ccgtactgcggttaactgcaggtcgacgc & Reverse primer to order: GCGTCGACCTGCAGTTAACCGCAGTACGG

28. Vectors and Bacteria Strains An important thing to think about before you start cloning: What vectors/E Coli should I use?

29. lac Expression Regulation RNA polymerase Promoter Promoter Promoter lac site lac site lac site RBS RBS RBS ATG- your gene ATG- your gene ATG- your gene IPTG (or lactose, etc) X lac repressor Transcription IPTG mRNA

30. Purification Tags and Selection (Anti-biotic Resistance) • Anti-biotic resistance (working concentration) • Ampicillin (100g/mL) • Kanamycin (35g/mL) • Tetracycline HCl (10g/mL) • Chloramphenicol (170g/mL in ethanol) • Purification Tag • His-tag (nickel agarose resin) • Maltose Binding Protein (amylose resin) • Glutathione S-Transferase (glutathione resin)

31. Digestion of Insert and Vector • Digest with the same restriction endonucleases • Optional (recommended) step: • Treat the plasmid DNA with Antarctic phosphatase • Decreases the background by stopping self-ligation of singly cut plasmid and background re-ligation

32. Ligation of the Insert into the Vector + • Ligation covalently attaches the vector and the insert via a phosphodiester bond (5’phosphate and 3’ hydroxyl of the next base)

33. Antarctic Phosphatase and Ligation • Antarctic Phosphatase cleaves this phosphate, disallowing self-ligation • The insert still has the 5’ phosphate though http://www.neb.com/nebecomm/products/productM0202.asp

34. Transformation • The functional construct is now ready to be transformed into new E. Coli and grown up • The new DNA isolated from the E. Coli must then be sequenced to make sure that everything worked • Once the sequence is confirmed, we are ready to go!