Elements of Molecular Biology

1. Elements of Molecular Biology • All living things are made of cells • Prokaryotes, Eukaryotes

2. Cells • Cells is a basic unit of all living organisms. It stores all information to replicate itself • Nucleus, chromosomes, genes, … • Human genome is around 3 billions base pair long • Almost every cell in human body contains same set of genes • But not all genes are used or expressed by those cells

3. Terminology • Genomeis an organism’s complete set of DNA. • a bacteria contains ~ 600,000 DNA base pairs • human and mouse genomes have some 3 billion. • Chromosomes • Human genome has 24 distinct chromosomes. • Each chromosome contains many genes. • Gene • basic physical and functional units of heredity. • specific sequences of DNA bases that encode instructions on how to make proteins. • Genotype: Genetic makeup of an organism • Phenotype: Physical expressed traits of an organism

4. Elements of Molecular Biology • All life depends on 3 critical molecules • DNA • Hold information on how cell works • RNA • Act to transfer short pieces of information to different parts of cell • Provide templates to synthesize into protein • Proteins • Form enzymes that send signals to other cells and regulate gene activity • Form body’s major components (e.g. hair, skin, etc.) • Central dogma

5. O C 5th C 3rd C the national health museum DNA DNA composed of four nucleotides or "bases": A,T,C,G

6. DNA is composed of Four Nucleotides, Adenine (A), Guanine (G), Thymine (T) and Cytosine (C)

7. Four types of nucleotides of DNA Note that A pairs with T; and C pairs with G.

8. Nucleotides are joined together to form phosphodiester bonds

10. DNA Structure 5’ 3’

11. DNA Replication

12. RNA RNA composed of four bases: A,C,G,U (T transcribed as U)

13. Proteins Amino Acid

14. Side chain R O H N C C OH H H Aminogroup Carboxylgroup Proteins are composed of amino acids • Basic Amino AcidStructure: • The side chain, R,varies for each ofthe 20 amino acids

15. Protein

16. Central Dogma of Molecular Biology • DNA  RNA  protein • Sequence  structure  function

17. Gene expression translation transcription DNA RNA protein A string of the alphabet {A,C,G,T} Ex. CCTAAGA A string of the alphabet {A,C,G,U} Ex. CCUAAGA A string of the alphabet {20 amino acids} Ex. TGFIKYL Central Dogma

18. DNA to RNA to Protein • A gene is expressed in two steps: Transcription: RNA synthesis; Translation: Protein synthesis

19. Transcription

20. Transcription • Transcription is accomplished by RNA polymerase • RNA polymerase binds to promoters • promoters have distinct regions "-35" and "-10" • efficiency of transcription controlled by binding and progression rates • transcription start and stop affected by secondary structure • regulatory sequences can be positive or negative

21. Translation (animation)

22. Translation • conversion from RNA to protein is by codon: 3 bases = 1 amino acid • translation done by ribosome and tRNA • translation efficiency controlled by mRNA copy number (turnover) and ribosome binding efficiency • translation affected by mRNA tertiary structure

23. More on Translation the national health museum

24. Start: AUG Stop: UAA, UAG, UGA

25. DNA to RNA to Protein • A gene is expressed in two steps: Transcription: RNA synthesis; Translation: Protein synthesis

26. Biology, 7/c, Peter H. Raven • Gene expression http://highered.mcgraw-hill.com/sites/0072437316/student_view0/chapter18/animations.html#

27. Exercise • Translate the following DNA to a protein: …ctatgcccaagctgaaaaatgagcgtaatgaggtcatcat… -3’ …gatacgggttcgactttttactcgcattactccagtagta… -5’ template