1 / 11

Characterisation of the comABCDE pathway in S. pneumoniae

Characterisation of the comABCDE pathway in S. pneumoniae. Megan Aylward. 19/06/08. Overview. Background What comABCDE regulates When it is switched on/off Possible negative feedback. Overview. Components. Characterisation of the promoter region. Difficulties in finding the information

lainey
Download Presentation

Characterisation of the comABCDE pathway in S. pneumoniae

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript

  1. Characterisation of the comABCDE pathway in S. pneumoniae Megan Aylward 19/06/08

  2. Overview • Background • What comABCDE regulates • When it is switched on/off • Possible negative feedback

  3. Overview

  4. Components

  5. Characterisation of the promoter region • Difficulties in finding the information • ComX with RNA polymerase haloenzyme binds to cin-box –tacgaata • Strength information not available

  6. Identification of promoter region • BLAST analysis against S. pneumoniae genome • Clustal alignment • Tried to find the promoter region in the genome cin-box ------------------------------TACGAATA---------------------- section CGAATAATTCTTTTCTATTTATTTGACCTTTACAAATAAAATGGTAACTGTGACTAATAA embl|U76218|U76218 AAAAGGATTTTCTACTCTTACTTTTATTATTG-GGGGAAGTTTAGGATTGTCATCATCTG

  7. Model • Karlsson et al (2007) • Variables within their model include;

  8. Parameters • ComCDE- Basal synthesis, maximal synthesis, ComE-P conc. required • All components are assumed to undergo natural decay • Some parameters from literature where available

  9. Modelling in COR :there is one or several problems with units in this equation

  10. Running COR ComD model Problem with the CVODE integrator: at t=0 and h=2.18217e-0.15, the corrector convergence test failed repeatedly or with |h|=hmin.

  11. Future Modelling • Draft COR model for ComD has been generated • Other components need more information • Learn differential equations

More Related