1 / 1

31 87 pSAT4.hspP. EGFP

Clone number in the collection. Clone number in the collection. Vector name. Insert template. 2 298 pSAT6.35SP.MCS.35ST. 31 87 pSAT4.hspP. EGFP. BamHI - EGFP -F SpeI - EGFP -R. CGATGAGGATCCGTGAGCAAGGGCGAGGAGC. GATACAACTAGTCTTGTACAGCTCGTCCATG. Restriction enzymes. PCR primers. BamHI

lance
Download Presentation

31 87 pSAT4.hspP. EGFP

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript


  1. Clone number in the collection Clone number in the collection Vector name Insert template 2298 pSAT6.35SP.MCS.35ST 3187 pSAT4.hspP.EGFP BamHI-EGFP-F SpeI-EGFP-R CGATGAGGATCCGTGAGCAAGGGCGAGGAGC GATACAACTAGTCTTGTACAGCTCGTCCATG Restriction enzymes PCR primers BamHI SpeI BamHI SpeI pSAT6.35SP.EGFP.35ST Resulting clone

More Related