1 / 36

Announcements

Announcements. Candidate genes for behavioral ecology Trends in Ecology and Evolution , pages 96-104 Feb. 2005 Fitzpatrick, Ben-Shahar, Smid, Vet, Robinson, Sokolowski. Additivity or dominance : the effect of one allele on another allele at the same genetic locus.

lani-lawson
Download Presentation

Announcements

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript


  1. Announcements

  2. Candidate genes for behavioral ecology Trends in Ecology and Evolution, pages 96-104 Feb. 2005 Fitzpatrick, Ben-Shahar, Smid, Vet, Robinson, Sokolowski

  3. Additivity or dominance: the effect of one allele on another allele at the same genetic locus. Epistasis: the effect of one genetic locus on another independent locus. Pleiotropy: the effect of a single gene or two or more phenotypic traits. Polygenic: the effect of two or more genes on a single phenotypic trait. Phenotypic plasticity: the interaction between genetic factors and the environment (e.g, norm of reaction).

  4. Variation in gene sequence (polymorphisms, allelic differences) atgtcagccgataactcattgatcgtaaattgagtttt atgtcagccgataactgactgatggtaaattgagtttt Variation in gene expression (mRNA abundance)

  5. Juvenile hormone analog (methoprene) accelerates the onset of foraging and causes forager-like changes in brain gene expression (in the absence of experience) “marker” genes Treat with methoprene (JH analog) Caged bees (no task-related experiences) Whitfield CW et al. PNAS. 2006. Oct 31; 103(44):16068-75.

  6. Queen mandibular pheromone (QMP) delays the onset of foraging and causes nurse-like changes in brain gene expression (in the absence of experience) “marker” genes Treat with QMP Caged bees (no task-related experiences) Grozinger CM, Sharabash NM, Whitfield CW, Robinson GE. PNAS. 2003. Nov 25; 100:14519

  7. Proximate studies: genetic variation for behavioral variation is maintained. Ultimate studies: why is genetic variation maintained if selection usually acts to decrease variation!?! Fitness benefits of genetic variants are not constant, but depend on environment, and the environment is variable?

  8. Back to rovers and sitters.

  9. Back to rovers and sitters – why are there two feeding strategies? Hypothesis: Sitting is best strategy at low densities, while roving is best in high densities. Test: Raise random sets of larvae in different environments and measure average movement after several generations.

  10. Developmental flexibility & Developmental homeostasis Proximate: What are they? Ultimate: Why did they evolve?

  11. Developmental flexibility: a change in the development & production of a behavior based on variation in environment. Examples:learned behaviors, hormonal effects on behaviors, just about everything except behavioral differences due entirely to genetic differences!

  12. Kin discrimination The capacity of an individual to react differently to others based upon their degree of genetic relatedness.

  13. Kin discrimination • Social and aggressive behaviors: “associate with kin and be aggressive to nonkin” • 2) Sexual behaviors: inbreeding avoidance - “associate (mate) with nonkin”

  14. Learned kin discrimination: Imprinting Paper wasps (Polistes) imprint on odors of nest & nestmates and are aggressive towards individuals with non-familiar odors. nestmatesnon-nestmates

  15. Learned kin discrimination: Phenotype Matching (aka the “armpit effect”) Compare a foreign phenotype to your own phenotype.

  16. Learned kin discrimination: Phenotype Matching (aka the “armpit effect”) Compare a foreign phenotype to your own phenotype. MHC alleles: Genes that function in immune response and are some of the most variable (# alleles) genes known. Basis for odor-based phenotype matching in fish, mice and humans.

  17. Major Histocompatibility Complex (MHC). MHC genes play a central role in immune recognition. influence odors and mating preferences in vertebrates MHC genes are among the most polymorphic loci: There are a large number of alleles per locus (>100). Large sequence divergence between alleles. MHC allelic lineages are old (older than recent speciation events). So, for example, any given human MHC allele is more related to some alleles from chimpanzees and gorillas than it is to most other human alleles. From W. Potts, U. Utah

  18. Belding’s ground squirrels: Sisters reared apart are less aggressive towards each other than other pairings. Why are brother-sister pairings so aggressive?

  19. Golden Hamsters: Discriminate unfamiliar kin from familiar and unfamiliar non-kin (work by Jill Mateo, University of Chicago)

  20. Normal vs. cannibal forms in tiger salamanders Individuals can develop as normal predatory larvae or switch over to a cannibal form. Switch to cannibalism affected by: Population density Size differences Drying of water source Genetic relatedness to others

  21. Innate kin discrimination: Genotype Matching (aka the “green beard effect”) term coined by Richard Dawkins A gene gives individuals both a conspicuous trait (such as a green beard) and a tendency to act favorably to others with that same trait, mutual altruism between individuals could evolve (in the absence of kinship). Dawkins “The Selfish Gene” 1976

  22. Evidence for “green beards” in nature: Different alleles for Gp-9 locus in fire ants influence whether workers will adopt or kill new queens. Ross and Keller 1998. Selfish genes: a green beard in the red fire ant. Nature

  23. Evidence for “green beards” in nature: The csA gene in Dictyostelium discoideum promotes cell adhesion only for like genotypes. Queller_et al. 2002. Single gene green beard effects in a social amoeba. Science

  24. Developmental homeostasis: Development of specific behaviors despite variation in environment This category includes, but is not limited to innate behaviors

  25. Rewiring the ferret brain Despite having completely novel sensory inputs, the auditory cortex was able to develop into a functioning processing center for visual signals!

  26. Developmental homeostasis within developmental flexibility!! Flexibility homeostasis homeostasis Normal predator Cannibal

  27. Why do developmental flexibility and homeostasis exist? Flexibility can account for important, but variable environmental conditions, leading to increased fitness under different conditions. Homeostasis reduces the chance of devastating developmental errors due to environmental deficits/changes

  28. Evidence for ultimate benefits of developmental flexibility Anolis lizards: morphology of hind legs changes when raised on large trunks or small branches. Hypothesis: this flexibility leads to increased running performance in a specific environment. Test: compare running speed/performance of lizards with different morphologies in both environments Prediction: “trunk” morphology performs better on trunks while “branch” morphology performs better on branches

  29. Evidence for ultimate benefits of developmental flexibility Anolis lizards: morphology of hind legs changes when raised on large trunks or small branches. Losos et al. 2002 Evolution

  30. Evidence for ultimate benefits of developmental homeostasis Wolf spiders: smaller males in poorer condition tend to have more asymmetrical tufts on forelimbs Hypothesis: females use tuft symmetry in mate choice as indicator of level of homeostasis Test: digitally manipulate tuft asymmetry on videos of male wolf spiders courting females and measure female receptiveness. Prediction: females will be more receptive to symmetrical males than asymmetrical males.

  31. Evidence for ultimate benefits of developmental homeostasis Wolf spiders: smaller males in poorer condition tend to have more asymmetrical tufts on forelimbs Female spiders found video of control males more stimulating than asymmetrical males. Why measure fluctuating asymmetry? Uetz and Smith. 1999 Behavioral Ecology and Sociobiology

  32. Directional asymmetry A pattern of bilateral variation due to developmental differences (predictable and subject to selection).

  33. Fluctuating asymmetry A pattern of bilateral variation where variation on the right and left sides is both random and independent. It tends to be small (around 1% of trait size or less) Has become a popular measure of ‘quality’, ‘stress’, ‘health’ or ‘fitness’ (e.g., increased stress experienced during development often yields increased fluctuating asymmetry) However, its developmental origins remain obscure and are much debated.

  34. Environmental quality (FA is higher in poorer quality habitats) Stress (stress during development increases FA) Hybridization (FA is higher in hybrids between species) Inbreeding (inbreeding increases FA) Heterozygosity (FA decreases with increasing heterozygosity) Mate Choice (females prefer more symmetrical males)

  35. Low Symmetry High Symmetry Perfect Symmetry Normal Facial Symmetry and Attractiveness From Koehler et al. 2002

  36. Randy Thornhill Facial Symmetry and Attractiveness • Evaluating original images and computer-generated composite images, participants rated faces in terms of attractiveness, dominance, sexiness and health. • More symmetrical faces were given higher ratings. • Male faces with larger features demonstrating male secondary sexual characteristics (large square jaw) were preferred by females. From Grammer & Thornhill 1994

More Related