1 / 43

The “Gurdon” experiment :

R. R. R. R. R. R. R. r. r. r. r. r. r. r. The “Gurdon” experiment :. Does every cell in an organism contain all the genetic information to make a complete individual?. Host egg. Unfertilized egg. Ultraviolet radiation of egg to destroy nucleus. Enucleated egg. Host egg.

latonial
Download Presentation

The “Gurdon” experiment :

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript

  1. R R R R R R R r r r r r r r

  2. The “Gurdon”experiment: Does every cell in an organism contain all the genetic information to make a complete individual?

  3. Host egg Unfertilized egg Ultraviolet radiation of egg to destroy nucleus Enucleated egg

  4. Host egg Donor nucleus

  5. Host egg Donor nucleus

  6. How is genetic information copied every time a cell divides? The two strands separate and each strand is used as a template for the synthesis of a new strand.

  7. How is genetic information copied every time a cell divides? DNA polymerase is the enzyme (protein) that carries out DNA replication.

  8. Bacteria have about 5 million basepairs of DNA. Bacteria can divide every 20 minutes. DNA polymerase replicates bacterial DNA at a rate of 4200 basepairs/second.

  9. one gene one protein What is a gene? Genes are the basic units of inheritance. Genes are information to make proteins.

  10. Most higher organisms have 15,000 - 35,000 different genes These organisms have the information (DNA) to make 15,000 - 35,000 different proteins

  11. How is genetic information stored in DNA? As a sequence of bases (ATGCATTCGCAATT…)

  12. The sequence of bases in DNA determines The sequence of amino acids in a protein determines The 3-D shape of the protein determines the sequence of amino acids in a protein. the 3-D shape of the protein. the function of the protein.

  13. Hemoglobin

  14. DNA Polymerase

  15. DNA cutting enzyme

  16. Receptor protein

  17. Genes are arranged on chromosomes like beads on a string DNA Gene 1 Gene 2 Gene 3 Gene 4 Gene 5

  18. Humans have 23 pairs of chromosomes (46 total) Fruit Flies have 4 pairs of chromosomes (8 total) Arabidopsis has 5 pairs of chromosomes (10 total) Chromosome Gene 1 Gene 2 Gene 3 Gene 4 Gene 5 A typical chromosome has thousands of genes

  19. Protein 1 Protein 2 Protein 3 Protein 4 Protein 5 Genes code for proteins chromosome Gene 1 Gene 2 Gene 3 Gene 4 Gene 5

  20. Central Dogma of Biology

  21. Transcription: DNA RNA nucleus cytoplasm DNA RNA

  22. RNA is transported to cytoplasm cytoplasm nucleus DNA RNA RNA

  23. Translation: RNA protein cytoplasm nucleus DNA RNA protein

  24. DNA RNA protein cytoplasm nucleus DNA RNA RNA protein

  25. Properties of DNA Double stranded Deoxyribonucleic acid Bases: A, G, C and T Properties of RNA Single stranded Ribonucleic acid Bases: A, G, C and U (U = uracil)

  26. Central Dogma of BiologyDNA RNA protein DNA (bases) … GGC TGT GGC TAG … CCG ACA CCG ATC transcription transcription RNA (bases) … GGC UGU GGC UAG

  27. The code in RNA is read three bases at a time transcription translation

  28. Central Dogma of BiologyDNA RNA protein DNA (bases) … GGC TGT GGC TAG … CCG ACA CCG ATC transcription transcription RNA (bases) … GGC UGU GGC UAG translation translation Protein (amino acids) … Gly

  29. Central Dogma of BiologyDNA RNA protein DNA (bases) … GGC TGT GGC TAG … CCG ACA CCG ATC transcription transcription RNA (bases) … GGC UGU GGC UAG translation translation Protein (amino acids) … Gly - Cys

  30. Central Dogma of BiologyDNA RNA protein DNA (bases) … GGC TGT GGC TAG … CCG ACA CCG ATC transcription transcription RNA (bases) … GGC UGU GGC UAG translation translation Protein (amino acids) … Gly - Cys - Gly

  31. Central Dogma of BiologyDNA RNA protein DNA (bases) … GGC TGT GGC TAG … CCG ACA CCG ATC transcription transcription RNA (bases) … GGC UGU GGC UAG translation translation Protein (amino acids) … Gly - Cys - Gly Stop

  32. AUG codes for the amino acid methionine in all organisms (bacteria, fungi, plants, and animals) GGC codes for the amino acid glycine in all organisms (bacteria, fungi, plants, and animals) The Genetic Code is Universal

  33. The Genetic Code is Universal This fact proves one of Darwin’s most remarkable predictions: All life forms evolved from a common ancestor.

  34. What is a mutation? A mutation is a change in the base sequence in DNA that results in a change in the amino acid sequence of a protein.

  35. transcription transcription RNA … GGC UGU GGC UAG … GGC UAU GGC UAG translation translation Protein normal mutant … GGC TGT GGC TAG … CCG ACA CCG ATC … GGC TAT GGC TAG … CCG ATA CCG ATC DNA … Gly - Cys - Gly Stop … Gly - Tyr - Gly Stop

  36. ON OFF A gene is composed of two parts: regulatory region (on/off switch) coding region (codes for amino acids)

  37. …AGCCTACCAAAAAAGGTTCCACG… …TCGGATGGTTTTTTCCAAGGTGC… Transcription factors turn genes on and off. Transcription factors are proteins that bind to a specific base sequence in DNA.

  38. Some transcription factors are activators: • They turn genes ON. regulatory region (on/off switch) coding region (codes for amino acids)

  39. Some transcription factors are activators: • They turn genes ON. - Some transcription factors are repressors: They turn genes OFF. regulatory region (on/off switch) coding region (codes for amino acids)

More Related