1 / 24

Use of SNP-DNA analysis in authenticating Basmati rice

Use of SNP-DNA analysis in authenticating Basmati rice. Summary. DNA based authentication of basmati rice Background to Single nucleotide polymorphisms (SNPs) Introduction to SNP genotyping using MALDI-ToF MS Authentication of basmati rice using MALDI-ToF MS-based SNP genotyping

lecea
Download Presentation

Use of SNP-DNA analysis in authenticating Basmati rice

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript

  1. Use of SNP-DNA analysis in authenticating Basmati rice

  2. Summary • DNA based authentication of basmati rice • Background to Single nucleotide polymorphisms (SNPs) • Introduction to SNP genotyping using MALDI-ToF MS • Authentication of basmati rice using MALDI-ToF MS-based SNP genotyping • Launching a commercial genotyping service

  3. Authentication of basmati rice by DNA genotyping • Micro-satellite markers • Single nucleotide polymorphisms

  4. TCGAAATGCATGCGCATGATT Variety 1 TCGAAATGCATGCGCGTGATT Variety 2 Single nucleotide polymorphisms Single nucleotide differences exist betweenindividuals, plant and animal varieties and bacterial strains

  5. Single nucleotide polymorphisms Authentication using SNPs • PCR based SNP genotyping • MALDI-ToF MS based SNP genotyping

  6. Assaying SNPs by MALDI-ToF MS Once a SNP is identified, 3 primers are required to enable genotyping including:- - Two PCR primers to amplify the region around the SNP 5’ 3’ - One Extension primer which anneals directly adjacent to the SNP. 5’ 3’

  7. TCGAAATGCATGCGCGTGATT TCGAAATGCATGCGCATGATT Anneal primer TTACGTACGCG TTACGTACGCG TCGAAATGCATGCGCATGATT TCGAAATGCATGCGCGTGATT +polymerase +ddNTP’s TTACGTACGCGT TTACGTACGCGC TCGAAATGCATGCGCATGATT TCGAAATGCATGCGCGTGATT Analyse extension products by MALDI-TOF MS Assaying SNPs by MALDI-ToF MS

  8. MALDI-TOF Mass Spectrometry Samples mixed with a matrix in great excess and spotted onto a MALDI plate and loaded into the Mass Spectrometer. Sample spot is subjected to repeated pulses of a nitrogen laser at 337nm in a vacuum which vaporises and ionises sample. Matrix absorbs the majority of incident laser energy, preventing degradation or fragmentation of the sample, and allows the vaporisation and ionisation of some of the substrate. Delayed application of an electric field causes ions to enter flight tube and accelerate towards detector. Delayed Extraction applies high voltage electric pulse after predetermined time delay to minimise energy spread of ions. All ions gain same kinetic energy, so larger ions take longer to reach detector. This variation in Time of Flight allows the separation of ions on the basis of size.

  9. Assaying SNPs by MALDI-ToF MS C = 273 Da T = 288 Da A = 297 Da G = 313 Da Difference in peak size reveals the SNP allele for that rice variety Unextended SNP primer Extended SNP primer

  10. Multiplexing SNP assays

  11. Quantitative SNP assays

  12. MALDI-TOF-based DNA authentication of basmati rice Sponsored by the FSA

  13. FSA sponsored work includes:- • Completing a SNP database for the main commercial varieties and their adulterants. • Assessing the reproducibility of the protocols to determine the uncertainty of the method. • Performing a limited survey of Basmati Products being sold in UK supermarkets. • Developing a Standard Operating Procedure

  14. Basmati rice varieties Traditional breeds Basmati 386 Basmati 370 Dehradun Ranbir Basmati Taraori (HBC-19) Hybrid Basmati 385 Super Basmati Pusa Basmati Kasturi Basmati 198 Common Adulterants Pusa 169 Sabarmati PR 106 Kali-much Lakra Saket 4 Parimal Sherbati Terricot

  15. Assembling a SNP database for Basmati varieties and adulterants

  16. Assessing reproducibility

  17. Examples of survey work

  18. SNP Genotyping using primer I Primer Primer + C Primer + T Tilda basmati Rice ASDA basmati rice

  19. SNP Genotyping using 11 primers Tilda basmati rice behaves like traditional variety Kernal Asda basmati rice is most like the basmati hybrid Pusa

  20. Summary MALDI-ToF MS based genotyping represents an effective analytical approach to assess:- • Product authentication using a diagnostic panel of multiplexed SNP markers based on an expanded database. • Product adulteration, exploiting the techniques ability to quantitate SNPs in the 5-100% range.

  21. SNP analysis as a QC tool

  22. SNP analysis as a QC tool SNP markers revealed that results with the 2003 crop could NOT have arisen from mixing Super Basmati (S) with Thai (T) rice

  23. Au THENTIGENE THE gold standard Providing a commercial genotyping service Applying cutting-edge DNA technology to provide analytical services for product authentication to the food industry. http://Authentigene.com http://Authentigene.info

  24. The Authentigene team Prof. David Archer Prof. Malcolm Bennett Prof. Ian Connerton Dr. Sean May Prof. Gregory Tucker

More Related