1 / 1

CGCATT

|. TG. A. C. G. C. T. TA. A. A. A. (2 bits). TA. A. Matches for '. Matches for '. Seq. Seq. 0'. 0'. CTGW / (6. CTGW / (6. -. -. 10). 10). T. T. T. TA. Match. Match. Start. Start. Mismatches. Mismatches. Matches for '. Matches for '. Seq. Seq. 0'. 0'.

lela
Download Presentation

CGCATT

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript

  1. | TG A C G C T TA A A A (2 bits) TA A Matches for ' Matches for ' Seq Seq 0' 0' CTGW / (6 CTGW / (6 - - 10) 10) T T T TA Match Match Start Start Mismatches Mismatches Matches for ' Matches for ' Seq Seq 0' 0' (inverted repeat) (inverted repeat) Match Match Start Start R R Score Score CTGTatatactcACAG CTGTatatactcACAG 156 156 1 1 i i CTGTatatacacCCAG CTGTatatacacCCAG 177 177 1.5 1.5 CTGTatatactcACAG CTGTatatactcACAG 156 156 14.667 14.667 CTGGtttattgtGCAG CTGGtttattgtGCAG 115 115 2 2 CTGTatatacacCCAG CTGTatatacacCCAG 177 177 13.004 13.004 CTGTatatacTCAC CTGTatatacTCAC 156 156 2 2 TTGGataacccttCCAG TTGGataacccttCCAG 84 84 6.6409 6.6409 GT CGCATT TTGGATAACCCTTCCAG AATTCGATAAATCTCTGGTTTATTGTGCAGTTTATGGTTCCAAAATCGCCTT ATG TTG CTGTATATACTCACAG CATAA CTGTATATACACCCAG GGGGCGGA AAAGCGTTAACGGCCAGGCAACAAGA TG C T Dyad:

More Related