by Michael Y. Tolstorukov

1. by Michael Y. Tolstorukov Center for Biomedical Informatics, Harvard Medical School Division of Genetics, Brigham and Women’s Hospital Primary structure of chromatin: Signposts of the genome

3. DNA methylation Histone modifications nucleosomes

4. DNA methylation Histone modifications nucleosomes Histone variants H2A – ‘major’ variant macroH2A H2A.Z H2A.Bbd H3.1/H3.3 …..

5. How big is a nucleosome? ~100 Å

6. Sequencing experiment

7. Nucleosome positioning • Nucleosome composition

8. Is nucleosome positioning encoded in the genome? Two points of view: DNA sequence plays a major role in formation of the nucleosomal patterns Kaplan, Widom, Segal, et al. “The DNA-encoded nucleosome organization of a eukaryotic genome.” Nature 458, 362-6 (2009) Other factors mainly determine nucleosome positioning Zhang, Struhl, et al. “Intrinsic histone-DNA interactions are not the major determinant of nucleosome positions in vivo.” Nat Struct Mol Biol 16, 847-52 (2009)

9. 10-bp periodicity Major groove minor groove minor groove 10 bp DNA bending occurring every 10-bp into one of the grooves accumulates and this is favorable for nucleosome formation Some short sequence motifs, such as A-tracts, are known to introduce DNA bending 10-bp periodicity was first observed in nucleosomal sequences 30 years ago (Trifonov et al., PNAS, 1980)

10. Human H2A.Z and H3K4me3 nucleosomes: Barsrki et al., Cell 2007 Human ‘bulk’ nucleosomes: Schones et al., Cell 2008 Yeast H2A.Z nucleosomes Albert et al., Nature 2007 Tolstorukov et al., Genome Res, 2009

11. 5’  3’ Short read sequencing data 3’ 5’

12. fine-grain density coarse-grain density 5’  3’ Short read sequencing data 3’ 5’ size dyad position Kharchenko, Tolstorukov, Park, Nature Biotech 2008 Tolstorukov et al., Genome Res 2009

13. Tolstorukov et al, Epigenomics, 2010

14. CTGAACGTGGGTCTCAGTGGTGAGTAGCTGATG CTTCGCGTGTATCAGTGATGTCTGCAGCGTGAG ACTACCGTGTTCTCAGTGGTGAGTAGCTGGAAG Yeast WW [AA, TT, AT, TA] Human SS [GG, CC, GC, CG] Human WW [AA, TT, AT, TA] Yeast SS [GG, CC, GC, CG] Tolstorukov et al., Genome Res, 2009

15. Power spectral analysis of dinucleotide distribution in nucleosomal sequences

16. Other nucleosome positioning signals: Step-like profile of GC-content contributes to nucleosome positioning Human nucleosomes position relative to dyad, bp Kharchenko, Woo, Tolstorukov, et al. Genome Res, 2008 nucleosome deformation energy Tolstorukov et al., Mol Biol2007 Tolstorukov et al., Bioinformatics, 2008 position relative to dyad, bp

17. Are nucleosomal positions conserved?

18. Sequence variations around stable nucleosome positions in human genome Tolstorukov et al., Nat Struct Mol Biol, 2011

19. SNPs in gene-start proximal regions frequency distance, bp frequency distance, bp

20. Interplay between selection and mutability in chromatin context Transcription factors binding sites SNP rate Indel rate Selection Indels occurrence SNPs

21. Is nucleosome positioning encoded in the genome? Depends on organism and nucleosome type: Stronger role of sequence in lower organisms Stronger role of sequence in case of ‘epigenetic’ nucleosomes

22. Comparative profiling of histone H2A variants

23. Phylogeneticrelationship among H2A variants

24. H2A.Z Suto et al., Nat Struct Biol. (2000) 7(12):1121-4.

25. MacroH2A Chakravarthyet al., Mol. Cell. Biol. (2005) 25:7616-7624

26. H2A.Bbd Bao et al., The EMBO Journal (2004) 23:3314-3324

27. THE EXPERIMENT mac-FLAG H2A-FLAG Bbd-FLAG Z-FLAG Stable HeLa S3 Native chromatin IP and clone DNA for massively parallel sequencing (Solexa)

28. Tag density cross-correlation protected region is the number of tags whose 5’ end maps to the position x on the strand s of chromosome c, Nc, N are the number of tags mapped to chromosome c and the total number of tags

29. Over-digestion, internal cuts protected region Changes in nucleosome shape protected region

30. Tag density auto-correlation nucleosomal repeat

31. Snapshot of genome-wide distribution of H2A histone variants RNA-Seq H2A.Bbd macroH2A H2A.Z H2A

32. expression

33. H2A.Bbd is associated with elongating form of RNA Pol II

35. Functional and mechanistic aspects of H2A.Bbd story

36. Gene ontology analysis

37. shRNA-assisted depletion of H2A.Bbd affects expression phenotype

38. H2A.Bbd-enriched chromatin is associated with members of spliceosome and splicing factors U2 snRNP

44. Changes in exon inclusion rates upon H2A.Bbd depletion

45. Tag frequency (ChIP-Seq) around splicing junctions Branching point Exon 126 bp

46. Consistent with shorter DNA fragment organized by H2A.Bbd

47. Distinct roles of H2A variants Active transcription: Affects gene expression through interaction with spliceosome and elongating RNA Pol II Affects gene expression through interaction with TF, RNA Pol II H2A.Bbd H2A.Z TSS TTS Silencing: macroBbd TTS TSS

48. ACKNOWLEDGEMENTS Harvard Medical School Peter Park Peter Kharchenko Vidhu Choudhary Massachusetts General Hospital Robert Kingston Aaron Goldman Institut Andre Lwoff (France) Cristele Gilbert Vasily Ogryzko Dana-Farber Cancer Institute Charles Roberts Courtney Sansam Ted Koellhoffer SAIC-Frederic, NCI Natalia Volfovsky Robert Stephens Thank you!