Interleukin-2: Its role in treating HIV infected patients and the possible way to produce it

1. Interleukin-2: Its role in treating HIV infected patients and the possible way to produce it Prasit Faipenkhong Production group

2. Outlines • Introduction • Clinical aspect of aldesleukin (human IL-2 derivative) • Production aspect aldesleukin (human IL-2 derivative) • Summary

3. Introduction • Interleukin-2 (IL-2) • cytokines • helper T cells (CD4+ T cells), cytotoxic T cells (Tc, CD8+ • T cells), natural killer cells (NK cells) • induce proliferation and differentiation of CD4+ T cells • and cytotoxic T cells • induce B cell proliferation, stimulate macrophage • activity, increase number and toxicity of NK cells • production is decrease in HIV infected patients

4. Introduction • Aldesleukin • a human IL-2 derivative • recombinant DNA technique • absence of an N-terminal alanine, replacement of • cysteine with serine at position 125, absence of • glycosylation

5. Diagram of the amino acid sequence of aldesleukin

6. Introduction • Aldesleukin • possess immunological activities similar to those • observed with native IL-2 • has been approved by FDA for treating metastatic renal • cell carcinoma and metastatic melanoma • phase III clinical trials in HIV infected patients

7. Clinical aspect of aldesleukin • What Does the Research Show? • Who Should Use It? • Pregnant Women and Children • What About Side Effects? • How to Use It? • How to Get It?

8. What Does the Research Show? • Subcutaneous, intravenous, intramuscular • daily, weekly, monthly and every two months • very low doses (1 million International Units, or IU) to • higher doses (18 million IU) • Immunological benefits in several clinical trials • increase CD4+ cells without sustained increase in viral • load • Duration of intermittent IL-2 therapy appear to be • important

9. What Does the Research Show? • Subcutaneous injection is similar to intravenous infusion • improvement in immunological parameter • Lower dosage of IL-2 (3 MIU/day) are still effective • increase CD4+ counts • No difference in viral load in group receiving IL-2 + • antiretroviral therapy • IL-2 + HART may reduce the latent reservoir

10. What Does the Research Show? • French regulatory agency approve a Compassionate • Use Program of aldesleukin for people with CD4+ counts • below 200 and HIV levels below 1,000

11. Who Should Use It? • Can be used safely by people at all levels of CD4+ cell • counts • People with high detectable viral loads • People with an active infection, heart problems, lung • diseases, autoimmune diseases, DM, thyroid problems • People facing extreme fatigue

12. Pregnant Women and Children • Pregnant women • Children

13. What About Side Effects? • Flu-like symptoms • Swelling, redness, or lumps • Sinus congestion, low blood pressure, liver toxicity, • swelling due to water retention, nausea and vomiting, • diarrhea, peeling skin, changes in mental status, and • altered blood levels including albumin, potassium, • magnesium, calcium, red blood cells, and platelets • Worst on the last two or three days of a five-day course

14. What About Side Effects? • Oliguria or anuria, shortness of breath, high fever that • doesn't go away with OTC drugs, major changes in • mental status, faint, major swelling

15. How to Use It? • Subcutaneous, 9-15 MIU/day, bid, five consecutive days • every eight weeks • The time between courses of IL-2 therapy will be increased • by four-week period • Continuous intravenous, 9-18 MIU/day, five consecutive • days, every eight weeks

16. How to Get It? • several ongoing studies • off label use

17. Production aspect aldesleukin • Preparing IL-2 cDNA libraries • Screening and identification of IL-2 cDNA clones • Cloning of IL-2 gene into M13 vector • Oligonucleotide-directed Mutagenesis • Screening and Identification of Mutagenized Phage • Plaques • Recloning of the Mutagenized IL-2 Gene for Expression • in E. coli

18. Preparing IL-2 cDNA libraries • A collection of plasmid cloning vectors carrying both • complete or incomplete IL-2 cDNA • Procedure

19. Preparing IL-2 cDNA libraries PBL or Jurkat cells mitogen Collect of mRNA for IL-2 Convert to double strand DNA (cDNA) Join into a plasmid cloning vector IL-2 cDNA libraries Transform host cells

20. Synthesis of cDNA

21. Preparing IL-2 cDNA libraries PBL or Jurkat cells mitogen Collection of mRNA for IL-2 Convert to double strand DNA (cDNA) Join into a plasmid cloning vector IL-2 cDNA libraries Transform host cells

22. Screening and identification of IL-2 cDNA clones • To identify the colonies of host cells that carry complete • IL-2 cDNA • DNA hybridization, immunological assay, protein • activity • Rescreen with the probe, confirm by restriction mapping

23. DNA hybridization

24. Screening and identification of IL-2 cDNA clones • To identify clones that carry a specific plasmid-cDNA • construct • DNA hybridization, immunological assay, protein • activity • Rescreen with the probe, full length clones were identified • and confirmed by restriction mapping

25. Cloning of IL-2 gene into M13 vector • Single stranded DNA template • Procedure

26. Cloning of IL-2 gene into M13 vector

27. Oligonucleotide-directed Mutagenesis • To engineer the IL-2 gene in order to get the the IL-2 • derivative which has suited physical and chemical • properties • Cysteine125 to serine • Decrease an aggregated oligomeric form when isolated • from bacterial cells • Decrease an aggregated inactive oligomeric form upon • storage • Procedure

28. Oligonucleotide-directed Mutagenesis M13-IL2 (double strand) M13-IL2 (single strand) Add synthetic oligonucleotide primer GATGATGCTCTGAGAAAAGGTAATC Add Klenow fragment and dNTPs Add T4 DNA ligase Transform E. coli Produce M13 plaques

29. Screening and Identification of Mutagenized Phage Plaques • To identify clones that contain mutated sequence of IL-2 • gene • Procedure

30. Screening and Identification of Mutagenized Phage Plaques Hybridization Digest with restriction enzyme DdeI Inoculate one clone called M13-LW46 into a culture of JM103 E. coli Prepare RF-DNA from the pellet of cell culture plate

31. Recloning of the Mutagenized IL-2 Gene for Expression in E. coli • To express the mutagenized IL-2 gene • Procedure

32. Recloning of the Mutagenized IL-2 Gene for Expression in E. coli RF-DNA from M13-LW46 Plasmid pTrp3 Ligated plasmid called pLW46 Tranform into E. coli Restriction enzyme mapping E. coli transformed with pLW46

33. Restriction map of ptrp3 Restriction map of pLW46

34. Summary • Aldesleukin, human IL-2 derivative, is produced by • recombinant DNA technique. • It has been approved by FDA for treating certain types • of kidney and skin cancer. • Now, it is under phase III clinical trials in HIV infected • patients. • Principle of microbial growth, maximizing the efficiency • of fermentation process, bioreactors, typical large-scale • fermentation, harvesting microbial cells, disrupting • microbial cells, and downstream processing