1 / 30

Investigative Cases

Investigative Cases. BioQUEST Summer Workshop 2005. Joyce Cadwallader Robin Greenler Stacey Kiser Ethel Stanley.

lynch
Download Presentation

Investigative Cases

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript

  1. Investigative Cases BioQUEST Summer Workshop 2005 Joyce Cadwallader Robin Greenler Stacey Kiser Ethel Stanley >NY-99flamingoCCAACTACTGTGGAGTCGCACGGAAACTACTCCACACAGGTTGGAGCCACTCAGGCAGGGAGATTCAGCATCACTCCTGCGGCGCCTTCATACACACTAAAGCTTGGAGAATATGGAGAGGTGACAGTGGACTGTGAACCACGGTCAGGGATTGACACCAATGCATACTACGTGATGACTGTTGGAACAAAGACGTTCTTGGTCCATCGTGAGTGGTTCATGGACCT >NY-99equineCCAACTACTGTGGAGTCGCACGGAAACTACTCCACACAGGTTGGAGCCACTCAGGCAGGGAGATTCAGCATCACTCCTGCGGCGCCTTCATACACACTAAAGCTTGGAGAATATGGAGAGGTGACAGTGGACTGTGAACCACGGTCAGGGATTGACACCAATGCATACTACGTGATGACTGTTGGAACAAAGACGTTCTTGGTCCATCGTGAGTGGTTCATGGACCT

  2. The Rumor Author: Stacey Kiser, Lane CC bioquest.org/lifelines "I read on the Internet that you can get Mad Cow Disease from Altoids."

  3. "Well, they are made in Great Britain and they do have gelatin in them.”

  4. What do you think this case is about? What do you already know that relates to this case? What do you need to know to understand the case? How might this case be used to encourage students to use an interdisciplinary approach to problem solving?

  5. NSF recommends that faculty: • “Build into every course inquiry*, the processes of science, a knowledge of what practitioners do, and the excitement of cutting edge research.” • “involving the student in asking questions and finding answers” • Shaping the Future: New Expectations for Undergraduate Education in Science, Mathematics, Engineering and Technology NSF, 1996. (p. 53)

  6. Using investigative cases is one curricular approach to address these challenges.

  7. Cases: Definition A case study is a narrative - often with characters facing decisions or a dilemma. A case defines a problem space that learners will investigate.

  8. All use realistically complex problems All are multidisciplinary All ask learners to consider the events, decisions, facts Elements in Common

  9. Investigative Case Based Learning: ICBL • ICBL blends two established methods : cases and scientific inquiry • The cases provide a context. • Students engage in investigations related to the case. This includes lab, field, and computer activities. • Instruction is organized around the BioQUEST 3Ps.

  10. ICBL and the 3Ps • Problem Posing • Read case and analyze • Learn more in resources • Figure out questions to investigate • Problem Solving • Develop or use methods to answer questions • Use field, lab, computer simulations to inquire • Peer Persuasion • Present results – many possible formats!

  11. Find The Donor’s Dilemma case in the Biological Inquiry workbook.

  12. BEDROCKhttp://bioquest.org/bedrock/problem_spaces/index.php

  13. Using Bioinformatics for Researching Epidemiology http://bioquest.org/lifelines/biotech2003/llol_project_template.php?project_id=45

  14. >Russia-63 CCAACCACTGTGGAGTCGCATGGAAACTACCCCACACAGATTGGGGCCACTCAGGCAGGGAGATTCAGCATCACTCCTGCGGCGCCTTCATACACACTAAAACTTGGAGAGTATGGAGAGGTGACGGTGGACTGTGAACCCGATCAGGGATTGACACCAATGCATACTACGTGATGACTGTCGGAACAAAGACGTTCTTGGTCCATCGTGAGTGGTTTATGGACCTCAACCTCCCCTGGAGCAGTGCCGGAAGCACTGTGTGGAGGAACAGAGAGACGTTG >Azerbaijan-67 CCAACCACTGTGGAGTCGCATGGAAACTACCCCACACAGATTGGGGCGACTCAGGCAGGGAGATTTAGCATCACTCCTGCGGCGCCTTCATACACACTAAAACTTGGAGAGTATGGAGAGGTGACGGTGGACTGTGAACCACGATCAGGGATTGACACCAATGCATACTACGTGATGACTGTCGGAACAAAGACGTTCTTGGTCCATCGTGAGTGGTTTATGGACCTCAACCTCCCCTGGAGCAGTGCCGGAAGCACTGTGTGGAGGAACAGAGAGACGTTG >Azerbaijan-70 CCAACCACTGTGGAGTCGCATGGAAACTACCCCACACAGATTGGGGCGACTCAGGCAGGGAGATTTAGCATCACTCCTGCGGCGCCTTCATACACACTAAAACTTGGAGAGTATGGAGAGGTGACGGTGGACTGTGAACCACGATCAGGGATTGACACCAATGCATACTACGTGATGACTGTCGGAACAAAGACGTTCTTGGTCCATCGTGAGTGGTTTATGGACCTCAACCTCCCCTGGAGCAGTGCCGGAAGCACTGTGTGGAGGAACAGAGAGACGTTG >India-55 CCGACTACAGTCGAATCGCATGGCATCTACTCAACACAGCAGGGCGCCACTCAAGCAGGCCGGTTCAGCATAACTCCAGCCGCGCCATCATACACTCTAAAGCTTGGGGAATATGGAGAAGTCACTGTGGACTGCGAGCCCCGCTCGGGCATAGACACAAACGCGTACTATGTGATGACAGTTGGGACGAAGACGTTTCTAGTCCACCGAGAATGGTTCATGGACCT >Israel-98 CCAACTACTGTGGAGTCGCACGGAAACTACTCCACACAGGTTGGAGCCACTCAGGCAGGGAGATTCAGCATCACTCCTGCGGCGCCTTCATACACACTAAAGCTTGGAGAATATGGAGAGGTGACAGTGGACTGTGAACCACGGTCAGGGATTGACACCAATGCATACTACGTGATGACTGTTGGAACAAAGACGTTCTTGGTCCATCGTGAGTGGTTCATGGACCT >Italy-98 CCAACCACTGTGGAGTCGCATGGAAACTACTCCACACAGATTGGGGCCACTCAGGCAGGGAGATTCAGCATCACTCCTGCGGCGCCTTCATACACACTAAAGCTTGGAGAATATGGAGAAGTGACAGTGGACTGTGAACCACGGTCAGGGATTGACACTAATGCCTACTACGTGATGACTGTTGGAACAAAGACGTTTTTGGTCCATCGTGAGTGGTTCATGGACCT >Morocco-96 CCAACCACTGTTGAGTCTCATGGTAACTACTCCACACAGATTGGGGCCACTCAGGCAGGGAGATTCAGCATCACTCCTGCGGCGCCTTCATACACACTAAAGCTTGGAGAATATGGAGAAGTGACAGTGGACTGTGAACCACGGTCAGGGATTGACACCAATGCCTACTACGTGATGACTGTTGGAACAAAGACGTTTTTGGTCCATCGTGAGTGGTTCATGGACCT >NY-99flamingo CCAACTACTGTGGAGTCGCACGGAAACTACTCCACACAGGTTGGAGCCACTCAGGCAGGGAGATTCAGCATCACTCCTGCGGCGCCTTCATACACACTAAAGCTTGGAGAATATGGAGAGGTGACAGTGGACTGTGAACCACGGTCAGGGATTGACACCAATGCATACTACGTGATGACTGTTGGAACAAAGACGTTCTTGGTCCATCGTGAGTGGTTCATGGACCT >NY-99equine CCAACTACTGTGGAGTCGCACGGAAACTACTCCACACAGGTTGGAGCCACTCAGGCAGGGAGATTCAGCATCACTCCTGCGGCGCCTTCATACACACTAAAGCTTGGAGAATATGGAGAGGTGACAGTGGACTGTGAACCACGGTCAGGGATTGACACCAATGCATACTACGTGATGACTGTTGGAACAAAGACGTTCTTGGTCCATCGTGAGTGGTTCATGGACCT >Romania-96 CCAACCACTGTGGAGTCGCATGGAAACTACTCCACACAGATTGGGGCCACTCAGGCAGGGAGATTCAGCATCACTCCTGCGGCGCCTTCATACACACTAAAGCTTGGAGAATATGGAGAAGTGACAGTGGACTGTGAACCACGGTCAGGGATTGACACCAATGCTTACTACGTGATGACTGTTGGAACAAAGACGTTTTTGGTCCATCGTGAGTGGTTCATGGACCT >Connecticut-99 CCAACTACTGTGGAGTCGCACGGAAACTACTCCACACAGGTTGGAGCCACTCAGGCAGGGAGATTCAGCATCACTCCTGCAGCGCCTTCATACACACTAAAGCTTGGAGAATATGGAGAGGTGACAGTGGACTGTGAACCACGGTCAGGGATTGACACCAATGCATACTACGTGATGACTGTTGGAACAAAGACGTTCTTGGTCCATCGTGAGTGGTTCATGGACCT

  15. Rooted Tree Based on Clustal W Analysis of E-protein Nucleic Acid Sequences: WNV

  16. Warning! Case in Use

  17. Angela sighed as she held a copy of Derrick’s Malaise. “I’m supposed to come up with my own problems for study in this bio course?” she asked no one in particular. She re-read the short case.

  18. “What caused Derrick’s malaria?” Angela thought. The only thing Angela knew about malaria was that people got it when they lived in other countries.

  19. Angela noticed other students going to the computers or leafing through books at the front of the room. She decided to go to a computer herself. Using Google, she looked up malaria and found the Mosquito Bytes site.

  20. When the teacher walked by, he saw this on Angela’s screen. http://whyfiles.org/016skeeter/malaria2.html

  21. Do you think Angela is a good student? How could we help her? Student Notes for Using Cases http://serc.carleton.edu/files/introgeo/icbl/CaseUserNotes.doc

  22. Implementation and Developing Assessment Strategies http://serc.carleton.edu/introgeo/icbl/index.html

  23. Finding Cases Microbes Count! 2003. ASM Press Biological Inquiry: A Workbook of Investigative Cases. 2005. Benjamin Cummings

  24. Finding Cases http://bioquest.org/lifelines/index.html

  25. Finding Caseshttp://ublib.buffalo.edu/libraries/projects/cases/case.html

  26. Finding Cases https://www.mis4.udel.edu/Pbl/

  27. Photo credits for opening page http://www.foothill.fhda.edu/bio/programs/bioinfo/images/micro1.jpg Bioinformatics program at Foothills College, CA

More Related