The Case of the Druid Dracula: Clicker Case Version

1. by Norris Armstrong, Terry Platt, and Peggy Brickman The Case of the Druid Dracula: Clicker Case Version Adapted from Brickman (2004). The Case of the Druid Dracula. National Center for Case Study Teaching in Science, University at Buffalo, State University of New York.

2. CQ1: What is your blood type? A: A B: B C: AB D: O E: Don’t know

3. Evidence in the Courtroom • Blood was previously used for blood typing • Now it is used as a source of DNA • Which cells in the blood contain DNA? • Primarily rape cases • Paternity testing • Historical/missing persons investigations • Military “dog tag” • Convicted felon databases Uses for DNA fingerprinting

4. The Crime In a quiet corner of Wales in the village of Llanfairpwll, 90-year-old Mabel Leyshorn was murdered. Her murder had been not only brutal (her heart had been hacked out), but also creepy. It appeared as if Mabel’s blood had been collected in a small kitchen saucepan and tasted. The murder showed other signs of the occult: a candlestick and a pair of crossed pokers had been arranged near the body. - from BBC’s Crimewatch December 2001

5. The Crime Scene Further investigation indicated that this was no supernatural villain at work: the murderer had worn tennis shoes which had left distinctive footprints under the glass door that had been shattered by a piece of broken garden slate. Moreover, the windowsill had bloodstains on it; with any luck, the evidence recovery unit hoped to use it to help determine who had committed the crime.

6. Target Gene DNA in the Cell chromosome double stranded DNA molecule individual nucleotides

7. Enzymes Perform Replication Replication fork

8. Example: Amelogenin Gene • Target sequence to be copied in this gene is located in Intron 1 • Gene function: tooth enamel development • Copies on both X and Y chromosome • X copy is different from Y copy • X copy is shorter than Y copy • --- indicates missing bases on X 5’CCCTAGGGTCTATAACGCCTAGTGTGTTGATTC 5’ 3’GGGATCCCAGATATTGCGGATCACACAACTAAG 3’ Y: X: GTGTGTTGATTC 3’ CACACAACTAAG 5’ 5’CCCTAGGGTCTA---------GTGTGTTGATTC 5’ 3’GGGATCCCAGAT---------CACACAACTAAG 3’

9. Steps of PCR • Heat(95 ºC) to denature DNA strands • Cool (55 ºC) to allow primers to anneal • Warm (72 ºC) to allow Taq polymerase to extend newly forming DNA • Repeat steps #1-3

10. Amplifying DNA with PCR (Polymerase Chain Reaction) Thermal cycle Thermal cycle Thermal cycle Target region In 32 cycles at 100% efficiency, 1.07 billion copies of targeted DNA region are created

11. CQ6: Which of the strands of DNA could act as one of the two primers for the DNA sequence shown below? 5’-CCCTGGGCTCTGTAAATGTTTCTAAGTG-3’ 3’-GGGACCCGAGACATTTACAAAGATTCAC-5’ A: 3′ -ACTGTTAGA-5′ B: 3′ -AAATTTGGC-5′ C: 3′ -ATGCTTTGA-5′ D: 5′ -GGGACCCGA-3′ E: 5′ -CCCTGGGCT-3′

12. CQ7: If both of these were run through gel electrophoresis, which segment would go farther through the gel? • Y • X 5’CCCTAGGGTCTATAACGCCTAGTGTGTTGATTC 5’ 3’GGGATCCCAGATATTGCGGATCACACAACTAAG 3’ Y: X: 5’CCCTAGGGTCTA---------GTGTGTTGATTC 5’ 3’GGGATCCCAGAT---------CACACAACTAAG 3’ GTGTGTTGATTC 3’ CACACAACTAAG 5’

13. (-) Negative electrode (+) Positive electrode Gel Electrophoresis: Sizing DNA Fragments

14. CQ8: The DNA fragment indicated is approximately ____ base pairs in size. A: 300 B: 350 C: 580 D: 600 E: 700 bp?

15. Why do the two DNA fragments indicated differ in how bright they appear?

16. Additional Markers ---TCAT--- ---TCAT--- • Same pair in suspect 2: Short Tandem Repeats (STRs) • Chromosomes 11 of suspect 1: • Different people have different numbers of repeats on their chromosomes

18. Positions of STR regions used for this case study TPOX CSF1PO TH01 Each person is unique AMEL 18

19. Automated gels 110 bp 101 bp Amelog. MW

20. Druid Dracula: DNA testing • With kits, just add DNA sample with primers for amelogenin (XY) & different STR regions. • Amplify and electrophores. • An allele ladder shows all varieties in a population.

21. CQ9: The blood left at the crime scene was from a male. Which of the following DNA profiles could have come from the suspect? A: B:

22. CQ10: Is this enough to convict a suspect? A: Yes B: No

23. CQ11: Which suspect presents a profile compatible to the sample found at the crime scene? Suspect 1 Suspect 2

24. What are the Odds? • There are only a few different numbers of repeats that are seen in our population. • Ex: only 5 different TPOX STRS • After testing thousands of DNA samples, researches know the distribution of these different STRS in the general population.

25. CQ12: What is the probability that two people might have 5 and 7 repeats for the STR THO1 by random chance? A: 1/200 B: 1/206 C: 1/600 D: 1/1200 E: 1/2600

26. What are the Odds? CQ13: What is the probability that someone else at random would have the same pattern of THO1 5 & 7, TPOX 8 & 9, and CSF1PO 11 & 12? • 1/1600 • 1/7200 • 1/17600 • 1/172800 • 1/1555200

27. Hardman’s Arrest • Standard police work identified Matthew Hardman as a suspect. Preliminary DNA testing provided enough evidence to arrest Hardman on suspicion of murder. • During the arrest, a knife was found in his coat pocket. Subsequent DNA testing revealed two sources of DNA on the knife, one from Hardman and one matching the victim. The possibility of a random match was one in 73 million. • A search of Hardman’s dwelling produced magazines and evidence of accessing internet sites featuring how to become a vampire.  • Matthew Hardman was found guilty of murder on August 2, 2002, and sentenced to life imprisonment.