Chapter 6: PCR methods for analysis of DNA polymorphisms

1. Chapter 6: PCR methods for analysis of DNA polymorphisms PCR-RFLP STR (microsatellites) RAPD AFLP

2. Some methods to detect DNA polymorphisms • SNP analysis: by chip analysis or PCR • RFLP: e.g. sickle cell globin, sometimes no hybridisation necessary e.g. mitochondrial DNA • PCR e.g. followed by sequence analysis • PCR-RFLP: PCR, followed by restriction digest (e.g. ITS of rDNA or chloroplast DNA) • STR: short tandem repeats or microsatelites, usually detected by PCR • RAPD: random PCR • AFLP: PCR of selected restriction fragments

3. PCR-RFLP • A1 & A2 are 2 alleles of one locus • PCR primer pair is choosen to amplify this region • Restriction digest • DNA polymorphism results in differential cutting • Analysis on agarose gel • Very simple and cheap • Limited to certain DNA regions (ITS, cp genes,etc.) • Not very polymorphic

4. PCR-RFLP mon carp carv pal M M goud long pulchra micro V. goudotiana ‘carv’ Different Vasconcellea (highland papaya) species from Ecuador analysed by PCR-RFLP PCR on CpDNA-region trnK1-trnK2 then digest with AfaI

5. PCR-RFLP mon carp carv pal M M goud long pulchra micro CpDNA-region trnK1-trnK2 digest with AfaI Some species have the same pattern (more related?) Intraspecific variation

6. PCR-RFLP 4 intergeneric crosses: ♀ ♂ C. papayaV. parviflora C. papaya  V. goudotiana C. papaya V. cundinamarcensis C. papaya V. quercifolia  C. papaya V. parviflora F1 PCR-RFLP to analyse inheritance of organel DNA: maternal or paternal or biparental?

7. PCR-RFLP C. papaya (seed parent = ♀) V. cundinamarcensis(pollendonor = ♂) M pap 1 2 3 4 5 cun M pap 1 2 3 4 5 cun Chloroplast DNA K1K2/AfaI Mitochondrial DNA nad4/1-2 • cpDNA als mtDNA:maternal • for all intergeneric crosses tested

8. VNTR=variable number of tandem repeats • VNTRs are hypervariable due to mistakes during replication or recombination • Microsatellites or STR (Short Tandem Repeat) or SSR (Simple Sequence Repeat): are repeats of a motif of 2, 3 or 4 nucleotides many times (such as CAGCAGCAGCAGCAGCAGCAG) • Minisatelites were the first DNA fingerprints used in humans, they have larger motifs (tens of nucleotides) and are usually analysed by RFLP • These types of repeats have been found in all eukaryotes studied • Because of the high variability, they can be used to make individual DNA fingerprints

9. VNTR=variable number of tandem repeats Minisatelites are usually analysed via hybridisation = variant of RFLP-analysis  see RFLP, not much used anymore

10. VNTR=variable number of tandem repeats A diploid organism has 2 alleles of a minisatellite locus, but many alleles can be present in a population

11. Who did it? genetic fingerprints If enough loci are analysed, the banding pattern is specific for the individual

12. M C F1 F2 Who is the father? Every child (C) gets half of its DNA from the mother (M) and the other half from its father  F1 of F2? F2

13. STR= short tandem repeats genome1 genome2 Microsatellites (STR, short tandem repeats or SSR simple sequence repeats) are usually studied by PCR, with analysis on polyacrylamide gel, detection can be by silver staining or incorporation of radioactivity or fluorescence  simple, fast, very polymorphic, much information if on several loci  development time-consuming, loci need to be searched for and sequenced

14. STR= short tandem repeats Example: Combination of several single locus analyses (code of primer pairs on top) S1, S2, S3: the suspects U1 tot U7: sperm samples collected from several women that had been raped.

15. STR= short tandem repeats Single locus analyses can be combined on 1 gel if fragment sizes differ sufficiently and/or by incorporating different fluorescent colours.

16. RAPD • RAPD = random amplification of polymorphic DNA • Principle: one short primer (e.g. 10 nucleotides) is used in the PCR reaction, this primer binds where it finds homology (many places), if two primers are by chance pointing to each other and not too far away, they can give a PCR product PCR-product primer DNA

17. RAPD • Example: RAPD patterns of different populations of Heterodera schachtii and of some other Heterodera species (21-23)

18. RAPD Main advantages of RAPD: • Simple technique (analysis on agarose gel) • No sequence information needed to do this type of PCR  Main disadvantage: • Not very reproducible

19. AFLP • AFLP is a technique in which differences in restriction fragments are revealed by PCR, and this not for one locus but for a larger number of loci in one reaction • In a first step the restriction fragments are generated by using two different enzymes (a frequent tetra-cutter and a more rare hexacutter) • Adapters are ligated to these fragments in order to have known sequences for primer design • Selected fragments are amplified (to have between 50-150 bands on the gel) and separated by polyacrylamide gel electrophoresis (detection by autoradiography or fluorescence)

20. AFLP Amplified fragment length polymorphisms DNA First restriction digestion Second restriction digestion Adapter ligation

21. AFLP Selective fragment amplification R1 R2 Restriction enzyme digestion Adapter ligation common sequence 1 common sequence 2 Selective PCR amplification Selective bases AFLP primer 1 AC GC AFLP primer 2 Selective bases

22. AFLP • Selected fragments are amplified (to have 50-150 bands on the gel) and separated by polyacrylamide gel electrophoresis (detection by autoradiography or fluorescence) • This selection is made by using longer primers: every extra nucleotide decreases the number of fragments by 1/4, so 2 extra nucleotides on each primer will amplify 1/256 • By repeating this second amplification with other primer pairs (otherselective nucleotides) a different subset of the genome is amplified.

23. AFLP

24. AFLP  The main advantages of AFLP are • No need for known sequences in the genome • High reproducibility • Many loci are simultaneously analysed • By changing the selective nucleotides a different part of the genome (and thus different loci) can be analysed • Whole genome analysis is (theoretically) possible  The main disadvantage: complex procedure

25. AFLP About 70 samples Example of AFLP gel from individuals sampled from a tropical tree species About 30 - 40 bands visible

26. AFLP analysis of Vasconcellea species: detail C. papayaV. monoica V. palandensis V. parviflora V. weberbaueri ‘carv’ Primer pair EcoRIGA/MseIACAA Species-specific marker

27. 1 2 3 4 1 2 3 4 1 2 3 4 1 2 3 4 Choice of marker Sequence analysis Chip (SNP) analysis AFLP PCR-RFLP STR Nuclear DNA  Large number of loci  Many polymorphisms  Complex • ITS, chloroplast & mitochondrial DNA •  Cheap •  Fast and efficient • Little information • Low polymorphism Nuclear and chloroplast DNA  Extremely polymorphic  Codominant  Development time long Nuclear and chloroplast DNA  Lots of information  Expensive •  Large number of loci •  Many polymorphisms • Development time long • Expensive

28. Choice of marker • Depending on the level where polymorphisms need to be analysed, a different method has te be choosen • Level polymorphisms • Family > genus > species > cultivar or individual • Marker polymorphism • STR > SNP > AFLP > sequence > PCR-RFLP • If the level of polymorphism is low, for example below species level, a highly polymorphic marker needs to be choosen such as STR • For non-model organisms, SNP and STR are not usually available, AFLP is the fastest option, because for SNP/STR a lot of preparatory work is needed to find polymorphisms

29. For phylogeny: sequence alignment Comparison banding patterns PCR-RFLP RAPD AFLP For classification/diagnostics STR: for population genetics