1 / 31

Evidence of Evolution

Evidence of Evolution. Exploring Various Lines of Evidence for the Theory of Evolution. Lines of Evidence. DNA Sequences Comparative Anatomy Embryology Transitional Fossils Biogeography “Genetic Tool Kit”. DNA Sequences.

malik-hardin
Download Presentation

Evidence of Evolution

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript

  1. Evidence of Evolution Exploring Various Lines of Evidence for the Theory of Evolution

  2. Lines of Evidence • DNA Sequences • Comparative Anatomy • Embryology • Transitional Fossils • Biogeography • “Genetic Tool Kit”

  3. DNA Sequences • Scientists are able to isolate pieces of DNA and determine the actual sequence of nucleotides • Species that are more closely related tend to have more similarities in their DNA

  4. DNA Sequences • Leptin = protein hormone that is important for regulating body weight and metabolism • Mice without properly functioning leptin gene are morbidly obese (right) compared to normal mice (left) Leptin protein

  5. DNA Sequences • Compare actual sequences of DNA (leptin gene) between three different species= human, chimpanzee, mouse • Predictions: how much similarity will there be? Who will be most closely related?

  6. DNA Sequences • First 60 nucleotides: Human: gtaggaatcg cagcgccagc ggttgcaagg taaggccccg gcgcgctcct tcctccttct Chimp: gtaggaatcg cagcgccagc ggttgcaagg taaggccccg gcgcgctcct tcctccttct Mouse: gaggga tcc ctgctccagc agctgcaagg taaggcccggggcgcgctact ttctcctcca (Mouse sequence has been shifted to line up as much as possible.) REMEMBER: Mutations can arise in the DNA sequence in a variety of forms, including nucleotide replacement, insertion, deletion, sequence inversion, etc.

  7. DNA Sequences • Nucleotides 121-180: Human: agtcaggagg gatgcagggc ggatggctta gttctggact atgatagctt tgtaccgagt Chimp: agtcaggagg gaggcagggc ggatggctta gttctggact atgatagctt tgtaccgagt Mouse: aggtcatgtg gacagcttgg tgttgaattc agtagttttg cagcgaggga ctctgcagac Note how the mouse sequence compares, after so many mutations have accumulated. REMEMBER: Mutations can arise in the DNA sequence in a variety of forms, including nucleotide replacement, insertion, deletion, sequence inversion, etc. (Human and Chimp sequences are identical between nucleotides 61-120.)

  8. Comparative Anatomy Similarities in structures between species suggest they descended from a common ancestor. Note the color-coded bones for the limbs of these 4 mammals – though different, they share many similar bones. Describe the function of each animal’s limb on your handout.

  9. Comparative Anatomy • http://www.eskeletons.org/ • Click “Comparative Anatomy” link • Compare: human, chimpanzee, and squirrel monkey • Predictions: Who would be the most similar and why? What similarities and differences might you expect? • Follow the directions on your handout!

  10. Embryology Ernst von Baer (1828): the more closely related any two species are, the more similar their development as embryos. In this game, you will look at pictures of embryos and guess what animal it is. Is it a snake, chicken, possum, cat, bat or human? Write your guess down on your handout, before you look at the answer!

  11. Embryology Are you sure that’s your prediction? Snake!

  12. Embryology Are you sure that’s your prediction? Bat!

  13. Embryology Are you sure that’s your prediction? Cat!

  14. Embryology Are you sure that’s your prediction? Chicken!

  15. Embryology Are you sure that’s your prediction? Human!

  16. Embryology Are you sure that’s your prediction? Possum!

  17. Biogeography • Marsupial distribution across the globe: http://evolution.berkeley.edu/evolibrary/article/0_0_0/lines_11 • Distribution today split on two sides of globe – how? • Review a few facts of the distribution and marsupials, as well as the history of the Earth, then formulate hypothesis behind distribution Biogeography is the study of the large-scale or global pattern of distribution of species, including the history and causes of this distribution. For this activity, you will explore the history and cause behind the distribution of marsupials.

  18. Biogeography • Marsupial distribution across the globe: http://evolution.berkeley.edu/evolibrary/article/0_0_0/lines_11 • Distribution today split on two sides of globe – how? • Review a few facts of the distribution and marsupials, as well as the history of the Earth, then formulate hypothesis behind distribution Marsupials are a group of mammals that give birth to live young that develop in an outer pouch of the mother. Bandicoot Koala Opossum Sugar Glider Kangaroo

  19. Biogeography There is no evidence of any marsupials able to swim across the ocean. No marsupial has been observed wandering across the Asian mainland. There does not appear to be any route of migration between the two populations of marsupials. How do you think some marsupials ended up halfway across the world from the others?

  20. Biogeography Continental Drift over millions of years – watch the movement of land masses

  21. Biogeography Continental Drift + Distribution of Marsupials

  22. Biogeography Similar reptilian Mesosaurus fossils found in both South America and Africa  evidence of continental drift (couldn’t swim the ocean, no land bridge  continents once joined)

  23. Biogeography • Similar reptilian Mesosaurus fossils found in both South America and Africa (couldn’t swim the ocean, no land bridge) •  evidence of continental drift (continents once joined)

  24. Transitional Fossils • Archaeopteryx fossils: multiple specimen found in limestone in Germany

  25. Archaeopteryx: Berlin specimen

  26. Archaeopteryx: Eichstatt specimen

  27. Archaeopteryx: Solnhofen specimen

  28. Whale Evolution • Video about the transitional forms in the evolution of whales – mammals evolving from land back to sea • http://www.pbs.org/wgbh/evolution/library/03/4/l_034_05.html

  29. “Genetic Tool Kit” • Video about Homeobox genes and implications for evolution: • http://www.pbs.org/wgbh/evolution/library/03/4/l_034_04.html • Answer the questions on your handout

  30. Eye Evolution • Video about the evolution of the eye: • http://www.pbs.org/wgbh/evolution/library/01/1/l_011_01.html • Answer the questions on your handout

More Related