1 / 16

DNA is genetic material.

DNA is genetic material. TAATACGACTCACTATAGGGAGA. Parts are basic biological functions that can be encoded as genetic material. R0083. TAATACGACTCACTATAGGGAGA. R0083 Type: Promoter Family: Protein:DNA Activity: 2 PoPS Requires: C0083 Cell Type: Any Temp: < Tm

marva
Download Presentation

DNA is genetic material.

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript

  1. DNA is genetic material. TAATACGACTCACTATAGGGAGA

  2. Parts are basic biological functions that can be encoded as genetic material. R0083 TAATACGACTCACTATAGGGAGA R0083 Type: Promoter Family: Protein:DNA Activity: 2 PoPS Requires: C0083 Cell Type: Any Temp: < Tm Issues: None License: Public

  3. TetR CI Otet RBS Lambda cI Term.

  4. C0040 C0051 R0040 B0034 C0051 B0015

  5. C0040 C0051 R0040 B0034 C0051 B0015

  6. Devices are combinations of one or more parts that encode human-defined functions. C0040 to C0051 INVERTER C0040 C0051

  7. C0040 to C0051 INVERTER C0051 to C0010 INVERTER C0010 to C0040 INVERTER Systems are combinations of one or more devices that encode human-defined functions.

  8. C0040 C0051 R0040 B0034 C0051 B0015

  9. PoPS, Not Proteins! C0051 B0034 C0051 B0015 R0051 Endy D From Details to a Device http://openwetware.org/wiki/BE.180:Devices

  10. Endy D, Deese I, Wadey C Adventures in Synthetic Biology Nature 24 November 2005 http://openwetware.org/wiki/Adventures

  11. Systems Devices Parts DNA

  12. Device-level Diagram

  13. Device-Level Timing

  14. Parts-level Diagram

  15. Parts-level Layout

More Related