Genomes & their evolution

1. Genomes & their evolution Campbell & Reece Chapter 21

2. Genomics • study of a specie’s whole set of genes & their interactions • bioinformatics: use of computers, software, & mathematical modes to process & integrate biological informationfrom large data sets

3. Human Genome Project • sequencing the human genome • 1990 – 2003 • 20 large centers in 6 countries + many other small labs working on small parts of it

4. FISH Cytogenetic Map: chromosome banding pattern & location of specific genes by flourescence in situ hybridization (FISH) • b/4 Human Genome Project the # of chromosomes & their banding patterns known for many species • some human genes already located

5. FISH • method in which flourescently labeled nucleic acid probes allowed to hybridize to immobilized array of whole chromosomes • maps generated from this used as starting point

6. 3 Stages to Genome Sequencing • Linkage Mapping • Physical Mapping • DNA Sequencing

7. Linkage Mapping • ordering of genetic markers (1000’s) spaced thru-out chromosomes • order & spacing determined by recombinant frequencies • markers: genes, RFLPs, (restriction fragment length polymorphism) or STRs (short tandem repeats)

8. RFLP • in gel electrophoresis, fragments of DNA are separated by length • (-) charge of phosphate groups moves DNA thru gel (acting like a sieve) toward (+) end • resulting in: bands that each consist of thousands of DNA molecules of same length

9. RFLP • 1 useful technique has been to apply restriction fragment analysis to these bands  information about DNA sequences • restriction enzymes “cut” DNA at known nucleotide sequences then these fragments produced are put thru gel electrophoresis

10. RFLP • DNA can be recovered undamaged from gel bands (so can be used to prepare pure sample of individual fragments) • can be used to compare 2 different DNA molecules (2 alleles of same gene) if nucleotide sequence affects a restriction site: change in even 1 nucleotide will prevent the “cut”

11. RFLP (restriction fragment length polymorphism) • polymorphisms: variations in DNA sequence among a population • this particular type of sequence change is called RFLP (“rif-lip”) • if 1 allele contains a RFLP, digestion with the enzyme will produce a fragment of different length

13. Short Tandem Repeats: STR • technique used by forensic scientists • are tandemly repeated units of 2 to 5 base sequences in specific regions of the genome • # repeats present is highly variable person to person (polymorphic) • 1 individual’s may vary if has 2 alleles

14. STR • PCR (polymerase chain react is used to amplify particular STRs • quicker technique than RFLP analysis • can be used with less pure samples of DNA or if only have minute sample

15. PCR

16. 3 Stages to Genome Sequencing • Linkage Mapping • Physical Mapping • DNA Sequencing

17. Physical Mapping • ordering of large fragments cloned in YAC & BAC vectors • followed by ordering of smaller fragments cloned in phage & plasmid vectors • key is to make overlapping fragments & then use probes or automated nucleotide sequencing of ends to find the overlaps

18. YAC & BAC Yeast Artificial Chromosome Bacterial Artificial Chromosome • 1st cloning vector • carries inserted fragments million base pairs (bp) long • carries inserts of 100,000 – 300,000 bp

19. Physical Mapping • fragments from YAC & BAC put in order • each fragment cut into smaller pieces • which are then cloned in plasmids, ordered, & finally sequenced

20. DNA Sequencing • determination of nucleotide sequence of each small fragment & assembly of the partial sequences into the complete genome sequence • for human genome used sequence machines • sequencing of all 3 billion bps in haploid set of human chromosomes done at rate 1,000 bp/s

21. Human Genome Project • took 13 yrs • $100 million

22. Sequencing an Entire Genome

23. Whole-Genome Shotgun Approach • essentially skips the linkage mapping & physical mapping stages & starts with sequencing of DNA fragments from randomly cut DNA • computers then assemble the resulting very large # of short sequences into a single continuous sequence

24. Shotgun Approach

26. Application of Systems Biology to Medicine • 2007 – 2010 set out to find all the common mutations in 3 types of cancer (lung, ovarian, glioblastoma) by comparing gene sequences & patterns of gene expression in cancer cells compared to normal cells

27. Cancer Genes • # genes identified that had been suspect + genes that were not suspected • gives researchers point to develop new treatments aimed specifically @ these genes • 10 more cancers then studied (most common/most lethal)

28. Microarray Chip

29. Genomes Vary in Size, # of Genes, & Gene Density

30. # of Genes • Prokaryotic cells < Eukaryotic cells • Humans: expected 50,000 – 100,000 but have found < 30,000 • How do we get by with not many more genes than nematodes? • # proteins we have > # genes • vertebrates use alternative splicing of RNA transcripts

31. Gene Density • # genes in given length of DNA • eukaryotes generally have larger genomes but fewer genes in given # of bps • humans have 100’s – 1000’s times more bps but only 5 – 15 times as many genes • Sooooo: gene density lower in humans than in bacteria

32. Noncoding DNA • includes most of eukaryotic DNA • introns • most is noncoding DNA between genes

33. 1.5% of our genome codes for proteins, or is transcribed into rRNA or tRNA

34. Pseudogenes • former genes that have accumulated over a long time & no longer produce functional proteins

35. Repetitive DNA • sequences that are present in multiple copies in the genome • 75% of this repetitive DNA (44% of entire genome) is made up of units called transposable elements & related sequences

37. Transposable Elements & Related Sequences • found in both prokaryotes & eukaryotes • stretches of DNA that can move from one location to another w/in the genome • transposition: process where 1 transposable element moves from 1 site to different target site by a type of recombination process

38. “Jumping” Genes

39. Transposons • Gene that is “jumping” never actually completely detach from the cell’s DNA • original and new strands brought together by enzymes & other proteins that bind to DNA • 1st evidence came from studying genetics of Indian corn

41. Movement of Transposons & Retrotransposons • 2 types of eukaryotic transposons: • Transposons • move w/in genome by means of DNA intermediate • move & paste or cut & paste • both require enzyme transposase(encoded by transposon)

42. Retrotransposon • 2nd type of eukaryotic transposable element • move by means of RNA intermediate that is a transcript of retrotransposon DNA • always leave copy @ original site during transposition • RNA intermediate is converted back to DNA by reverse transcriptase (enzyme encoded by retrotransposon)

44. Other Repeating DNA • probably arises due to mistakes made during DNA replication or recombination • ~14% human DNA • ~1/3 of this duplications of long stretches of DNA • segments copied from 1 chromosomal location to another on same or different chromosome

45. Simple Sequence DNA • Contains many copies of tandemly repeated short sequences: • ATTGCGATTGCGATTGCGATTGCG • repeated units can be 2 – 500 nucleotides

46. Short Tandem Repeat (STR) • repeating units that are 2 to 5 nucleotides long • found on telomeres & centromeres (so may play structural role) • # of repeating units can vary w/in same genome and with different alleles • this diversity means STR’s can be used in preparing genetic profiles

48. Other Types of DNA • 1.5% of genome: genes that code for proteins, rRNA, tRNA • include introns & regulatory sequences associated with genes total amt is 25% of the human genome

49. Multigene Families • <1/2 genes present in 1 copy • multigene families: collections of 2 or more identical or very similar genes • some identical present in tandem, repeats code for an RNA or histone proteins

50. rRNA genes • repeated tandemly 100’s to 1000’s times in 1 to several clusters in genomes of multicellular eukaryotes • helps cells quickly make millions of ribosomes necessary for protein synthesis