1 / 23

How I Won the APL Problem Solving Competition

How I Won the APL Problem Solving Competition. Iryna Pashenkovska. Eastbourne, UK September 2014. H ow I heard about the contest ?. A cknowledgement. k-mer Counting (LD). k-mer Counting (LD). Count ←{+/ ⍵ ⍷ ⍺ }. Most Frequent k-mers (LD). Most Frequent k-mers (LD).

michon
Download Presentation

How I Won the APL Problem Solving Competition

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript


  1. How I Won the APL Problem Solving Competition Iryna Pashenkovska Eastbourne, UK September 2014

  2. How I heard about the contest?

  3. Acknowledgement

  4. k-mer Counting (LD)

  5. k-mer Counting (LD) Count←{+/⍵⍷⍺}

  6. Most Frequent k-mers (LD)

  7. Most Frequent k-mers (LD) ACGTTGCATGTCGCATGATGCATGAGAGCT

  8. Most Frequent k-mers (LD) 1 1 1 1 2 3 3 1 1 1 1 1 3 3 2 1 1 1 2 3 3 2 1 1 1 1 1 0 0 0 ⌈/

  9. Approximate Pattern Matching (MD)

  10. Approximate Pattern Matching (MD)

  11. Longest Shared Substring (HD)

  12. Longest Shared Substring (HD)

  13. Word Search (LD)

  14. Task 1 – Word Search(solution) (¯1+⍳¯1↑⍴p)⊖p

  15. T R E D U C E M O P R U K I W O R P E I N X A D M N P O E U W A A N A P N T R D H Y C D S R F A A I D I I S I P D T T S D C F S J V O E O E E T U M M O C S R R N F D A R T C M E B T J L Y Y O F A Z X Task 1 – Word Search(solution) 0 ? ? 0

  16. T R E D U C E M O P R U K I W O R P E I N X A D M N P O E U W A A N A P N T R D H Y C D S R F A A I D I I S I P D T T S D C F S J V O E O E E T U M M O C S R R N F D A R T C M E B T J L Y Y O F A Z X Task 1 – Word Search(solution) ⍪ (¯1+⍳¯1↑⍴p)⊖p

  17. Task 1 – Word Search(solution) (¯1+⍳¯1↑⍴p)⊖p,[1]'-'

  18. Task 1 – Word Search(solution)

  19. Task 1 – Word Search(solution)

  20. Getting Wordy (MD)

  21. Edit Distance (HD)

  22. Thank you for your attention!

More Related