Introduction to Python

Introduction to Python BCHB5242013Lecture 4 BCHB524 - 2013 - Edwards

Outline • Review • Homework #1 Notes • Control flow: if statement • Control flow: for statement • Exercises BCHB524 - 2013 - Edwards

Review • Printing and execution • Variables and basic data-types: • integers, floats, strings • Arithmetic with, conversion between • String characters and chunks, string methods • Functions, using/calling and defining: • Use in any expression • Parameters as input, return for output • Functions calling other functions (oh my!) • If statements – conditional execution BCHB524 - 2013 - Edwards

Homework #1 Notes • Python programs: • Upload .py files • Don't paste into comment box • Don't paste into your writeup • Writeup: • Upload, don't paste into comment box • Text document preferred • Don't submit Rosalind solutions • Rosalind grades recorded separately. BCHB524 - 2013 - Edwards

Homework #1 Notes • Multiple submissions: • OK, but… • …I'll ignore all except the last one • Make each (re-)submission complete • Grading: • Random grading order • Comments • Grading "curve" BCHB524 - 2013 - Edwards

Homework #1 Notes • Exercise 1: • Use -1,-2,-3 instead of 0,1,2 • Lots of people used [::-1] • Serial vs parallel • Exercise 2: • Translation frame (some got it!) • Human positions start at 1. BCHB524 - 2013 - Edwards

Control Flow: if statement • Execution path depends on string in seq. • Make sure you change seq to different values. # The input DNA sequence seq = 'atggcatgacgttattacgactctgtgtggcgtctgctggg' # Remove the initial Met codon if it is there if seq.startswith('atg'): print"Sequence without initial Met:",seq[3:] else: print"Sequence (no initial Met):",seq BCHB524 - 2013 - Edwards

Control Flow: if statement # The input DNA sequence seq = 'atggcatgacgttattacgactctgtgtggcgtctgctggg' # Remove the initial Met codon if it is there if seq.startswith('atg'): initMet = True newseq = seq[3:] else: initMet = False newseq = seq # Output the results print"Original sequence:",seq print"Sequence starts with Met:",initMet print"Sequence without initial Met:",newseq BCHB524 - 2013 - Edwards

Control Flow: if statement # The input DNA sequence seq = 'atggcatgacgttattacgactctgtgtggcgtctgctggg' # Remove the initial Met codon if it is there initMet = seq.startswith('atg'): if initMet: newseq = seq[3:] else: newseq = seq # Output the results print"Original sequence:",seq print"Sequence starts with Met:",initMet print"Sequence without initial Met:",newseq BCHB524 - 2013 - Edwards

Control Flow: if statement # The input DNA sequence seq = 'atggcatgacgttattacgactctgtgtggcgtctgctggg' # Remove the initial Met codon if it is there initMet = seq.startswith('atg') if initMet: seq = seq[3:] # Output the results print"Sequence starts with Met:",initMet print"Sequence without initial Met:",seq BCHB524 - 2013 - Edwards

Serial if statement # Determine the complementary nucleotide defcomplement(nuc): if nuc == 'A': comp = 'T' if nuc == 'T': comp = 'A' if nuc == 'C': comp = 'G' if nuc == 'G': comp = 'C' return comp # Use the complement function print"The complement of A is",complement('A') print"The complement of T is",complement('T') print"The complement of C is",complement('C') print"The complement of G is",complement('G') BCHB524 - 2013 - Edwards

Compound if statement # Determine the complementary nucleotidedefcomplement(nuc):if nuc == 'A': comp = 'T'elif nuc == 'T': comp = 'A'elif nuc == 'C': comp = 'G'elif nuc == 'G': comp = 'C'else: comp = nucreturn comp# Use the complement functionprint"The complement of A is",complement('A')print"The complement of T is",complement('T')print "The complement of C is",complement('C')print"The complement of G is",complement('G') BCHB524 - 2013 - Edwards

If statement conditions • Any expression (variable, arithmetic, function call, etc.) that evaluates to True or False • Any expression tested against another expression using: • == (equality), != (inequality) • < (less than), <= (less than or equal) • > (greater than), >= (greater than or equal) • in (an element of) • Conditions can be combined using: • and, or, not, and parentheses BCHB524 - 2013 - Edwards

For (each) statements • Sequential/Iterative execution • Note use of indentation to define a block! # Print the numbers 0 through 4 for i inrange(0,5): print i # Print the nucleotides in seq seq = 'ATGGCAT' for nuc in seq: print nuc BCHB524 - 2013 - Edwards

For (each) statements # Input to program seq = 'AGTAGTTCGCGTAGCTAGCTAGCTATGCG' # Examine each symbol in seq and count the A's count = 0 for nuc in seq: if nuc == 'A': count = count + 1 # Output the result print"Sequence",seq,"contains",count,"A symbols" BCHB524 - 2013 - Edwards

For (each) statements # Examine each symbol in seq and count the A's defcountAs(seq): count = 0 for nuc in seq: if nuc == 'A': count = count + 1 return count # Input to program inseq = 'AGTAGTTCGCGTAGCTAGCTAGCTATGCG' # Compute count aCount = countAs(inseq) # Output the result print"Sequence",inseq,"contains",aCount,"A symbols" BCHB524 - 2013 - Edwards

For (each) statements # Examine each symbol in seq and count those that match sym defcountSym(seq,sym): count = 0 for nuc in seq: if nuc == sym: count = count + 1 return count # Input to program inseq = 'AGTAGTTCGCGTAGCTAGCTAGCTATGCG' # Compute count aCount = countSym(inseq,'A') # Output the result print"Sequence",inseq,"contains",aCount,"A symbols" BCHB524 - 2013 - Edwards

Exercise 1 • Write a Python program to compute the reverse complement of a codon • Use my solution to Homework #1 Exercise #1 as a starting point • Add the “complement” function of this lecture(slide 12) as provided. • Modularize! Place the reverse complement code in a new function. • Call the new function with a variety of codons • Change the complement function to handle upper and lower-case nucleotide symbols. • Test your code with upper and lower-case codons. BCHB524 - 2013 - Edwards

Exercise 2 • Write a Python program to determine whether or not a DNA sequence consists of a (integer) number of (perfect) "tandem" repeats. • Test it on sequences: • AAAAAAAAAAAAAAAA • CACACACACACACAC • ATTCGATTCGATTCG • GTAGTAGTAGTAGTA • TCAGTCACTCACTCAG • Hint: Is the sequence the same as many repetitions of its first character? • Hint: Is the first half of the sequence the same as the second half of the sequence? BCHB524 - 2013 - Edwards

Introduction to Python