1 / 59

More “What Perl can do” With an introduction to BioPerl Ian Donaldson Biotechnology Centre of Oslo

More “What Perl can do” With an introduction to BioPerl Ian Donaldson Biotechnology Centre of Oslo MBV 3070. Much of the material in this lecture is from the “Perl” lecture and lab developed for the Canadian Bioinformatics Workshops by Will Hsiao Sohrab Shah Sanja Rogic

min
Download Presentation

More “What Perl can do” With an introduction to BioPerl Ian Donaldson Biotechnology Centre of Oslo

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript

  1. More “What Perl can do” With an introduction to BioPerl Ian Donaldson Biotechnology Centre of Oslo MBV 3070

  2. Much of the material in this lecture is from the “Perl” lecture and lab developed for the Canadian Bioinformatics Workshops by Will Hsiao Sohrab Shah Sanja Rogic And released under the Creative Commons license

  3. http://creativecommons.org/licenses/by-sa/2.5/

  4. More “What can Perl do” • So far, we’ve had a very brief introduction to Perl • Next, we want to go a little deeper into • Use of “strict” • Perl regular expressions • Modules • An introduction to object-oriented Perl and • BioPerl

  5. strict

  6. Effects of “use strict” Correct Incorrect my $DNA; $DNA = “ATCG”; or my $DNA = “ATCG”; $DNA = “ATCG”; No warning Warning my $DNA = “ATCG”; $DNA =~tr/ATCG/TAGC/ my $DNA = “ATCG”; $DAN =~tr/ATCG/TAGC • Requires you to declare variables • Warns you about possible typos in variables

  7. Why bother “use strict” • Enforces some good programming rules • Helps to prevent silly errors • Makes trouble shooting your program easier • Becomes essential as your code becomes longer • We will use strict in all the code you see today and in your assignment • Bottom line: ALWAYS use strict

  8. Exercise 12 Write a program that has one function. Use a variable named “$some_variable” in this function and in the main body of the program. Prove that you can alter the value of $some_variable in the function without changing the value of $some_variable in the the main body of the program. Try it yourself (15 minutes) then check the answer at the end of this lecture.

  9. regular expressions

  10. What is a Regular Expression? • REGEX provides pattern matching ability • Tells you whether a string contains a pattern or not (Note: it’s a yes or no question!)‏ Dog! Human’s best friend “My dog ate my homework” “Yesterday I saw a big black dog” “I have a golden retriever” Regular Expression looking for “dog” “No” since REGEX is case sensitive “Yes” or “True” “Yes” or “True” “No” or “False”

  11. Regular expressions are “regular” Look at these names for yeast open reading frame names. YDR0001W YDR4567C YAL0045W YBL0008C While they are all different, they all follow a pattern (or regular expression). 1. Y means yeast 2. some letter between A and L represent a chromosome 3. an ‘R’ or ‘L’ refers to an arm of the chromosome 4. a four digit number refers to an open reading frame 5. A ‘W’ or a ‘C’ refers to either the Watson or Crick strand You can write a regular expression to recognize ALL yeast open reading frame names.

  12. Perl REGEX example my $text = “The dog ate my homework”; if ($text =~ m/dog/){ print “The text contains a dog\n”; } • =~ mis the binding operator. It says: “does the string on the left contain the pattern on the right?” • /dog/ is my pattern or regular expression • The matching operation results in a true or false answer

  13. Regular Expressions in Perl • A pattern that match only one string is not very useful! • We need symbols to represent classes of characters • For example, say you wanted to recognize ‘Dog’ or ‘dog’ as being instances of the same thing • REGEX is its own little language inside Perl • Has different syntax and symbols! • Symbols which you have used in perl such as $ . { } [ ] have totally different meanings in REGEX

  14. REGEX Metacharacters • Metacharacters allow a pattern to match different strings • Wildcards are examples of metacharacters • /.og/ will match “dog”, “log”, “tog”, “ og”, etc. • So . Means “any character” • Perl REGEX has much more powerful metacharacters used to represent classes of characters

  15. Types of Metacharacters . matches any one character or space except “\n” [ ] denotes a selection of characters and matches ONE of the characters in the selection. What does [ATCG] match? \t, \s, \n match a tab, a space and a newline respectively \w matches any characters in [a-zA-Z0-9] \d matches [0-9] \D matches anything except [0-9]

  16. Using metacharacters to build a regular expression YBL3456W /Y[A-L][RL]\d\d\d\d[WC]/ Is this a good pattern for a yeast ORF name? What else does it match? What if the name only has 3 digits?

  17. REGEX Quantifiers • What if you want to match a character more than once? • What if you want to match an mRNA with a polyA tail that is at least 5 – 12 A’s? “ATG……AAAAAAAAAAA”

  18. REGEX Quantifiers “ATG……AAAAAAAAAAA” /ATG[ATCG]+A{5,12}/ • + matches one or more copies of the previous character • * matches zero or more copies of the previous character • ? matches zero or one copy of the previous character • {min,max} matches a number of copies within the specified range

  19. REGEX Anchors • The previous pattern is not strictly correct because: • It’ll match a string that doesn’t start with ATG • It’ll match a string that doesn’t end with poly A’s • Anchors tell REGEX that a pattern must occur at the beginning or at the end of a string

  20. REGEX Anchors • ^ anchors the pattern to the start of a string • $ anchors the pattern to the end of a string /^ATG[ATCG]+A{5,12}$/

  21. REGEX is greedy! • The revised pattern is still incorrect because • It’ll match a string that has more than 12 A’s at the end • quantifiers will try to match as many copies of a sub-pattern as possible! /^ATG[ATCG]+A{5,12}$/ “ATGGCCCGGCCTTTCCCAAAAAAAAAAAA” “ATGGCCCGGCCTTTCCCAAAAAAAAAAAA”

  22. Curb that Greed! • ? after a quantifier prevents REGEX from being greedy /^ATG[ATCG]+?A{5,12}$/ “ATGGCCCGGCCTTTCCGAAAAAAAAAAAA” “ATGGCCCGGCCTTTCCGAAAAAAAAAAAA” • note this is the second use of the question mark - what is the other use of ? in REGEX?

  23. REGEX Capture • What if you want to keep the part of a string that matches to your pattern? • Use ( ) “memory parentheses” “ATGGCCCGGCCTTTCCGAAAAAAAAAAAA” /^ATG([ATCG]+?)A{5,12}$/

  24. REGEX Capture /^ATG([ATCG]+?)(A{5,12})$/ $1 $2 • What’s inside the first ( ) is assigned to $1 • What’s inside the Second ( ) is $2 and so on • So $2 eq “AAAAAAAAAAAA”

  25. REGEX Modifiers //i make pattern case insensitive //s let . match newline //m let ^ and $ (anchors) match next to embedded newline ///e allow the replacement string to be a perl statement • Modifiers come after a pattern and affect the entire pattern • You have seen //g already which does global matching (/T/g) and global replacement(s/T/U/g)‏ • Other useful modifiers:

  26. REGEX Summary • REGEX is its own little language!!! • REGEX is one of the main strengths of Perl • To learn more: • Learning Perl (3rd ed.) Chapters 7, 8, 9 • Programming Perl (3rd ed.) Chapter 5 • Mastering Regular Expression (2nd ed.) • http://www.perl.com/doc/manual/html/pod/perlre.html • A good cheat sheet is: http://www.biotek.uio.no/EMBNET/guides/guideRegExp.pdf

  27. Exercise 13 In a text file, write out three strings that match the following regular expression /^ATG?C*[ATCG]+?A{3,10}$/ Write a program that reads each string from the text file and checks your answers. Try it yourself (30 min) then look at the answer at the end of this lecture.

  28. modules

  29. What are Modules • a “logical” collection of functions • Using modules has the same advantage as using functions; i.e., it simplifies code (makes it modular) and facilitates code reuse • Each collection (or module) has its own “name space” Name space: a table containing the names of variables and functions used in your code

  30. Why Use Modules? • Modules allow you to use others’ code to extend the functionality of your program. • There are a lot of Perl modules.

  31. Finding out what modules you already have In Perl, each module is a file stored in some directory in your system. The system that this class is using, stores Perl modules (like cgi.pm) in one of two directories C:\bin\Perl\lib C:\bin\Perl\site\lib

  32. Finding out what modules you already have • To find out where modules are installed, type perl –V at the command prompt • To find out what is installed, type perldoc perllocal at the command prompt.

  33. Using Modules • To use a module, you need to include the line: use modulename; at the beginning of your program. • But you already knew that… use strict; use warnings;

  34. Where to find modules • You can search for modules (and documentation) that may be useful to your particular problem using http://search.cpan.org/ • CPAN: Comprehensive Perl Archive Network • Central repository for Perl modules and more • “If it’s written in Perl, and it’s helpful and free, it’s probably on CPAN” • http://www.perl.com/CPAN/

  35. Exercise14 Open a web browser Go tohttp://search.cpan.org/ Type in “bioperl Tools BLAST” Follow the link to Bio::Tools::Blast Browse through this page and the example code Make a .plx file like this: #bioperl example code use strict; use warnings; #make the bioperl module (class) accessible to your program use Bio::Seq; print"ok - ready to use Bio::Seq"; Does this programme run or return an error?

  36. Bioperl Overview • The Bioperl project – www.bioperl.org • Comprehensive, well documented set of Perl modules • A bioinformatics toolkit for: • Format conversion • Report processing • Data manipulation • Sequence analyses • and more! • Written in object-oriented Perl

  37. Bioperl Overview • The last exercise most likely did not work (unless you have BioPerl installed)‏ • So let’s install it…

  38. How to install modules • This class is using the active state version of Perl that comes with a program called ppm (Perl Package Manager)‏ • At the command prompt type >ppm And follow the instructions in the exercise 15

  39. How to install modules (without ppm)‏ • If you are not using active state Perl, you you can also install modules from CPAN using: >perl –MCPAN –e “install ‘Some::Module’” • Module dependency is taken care of automatically • You’ll (usually) need to be root to install a module successfully

  40. Exercise15 Install bioperl 1. At the command line prompt type >ppm 2. Then at the ppm prompt typeppm> search bioperl 3. Then typeppm> install bioperl Try this exercise at home. Installing libraries is not possible at UiO computers.

  41. What are objects? • Examples of objects in real life: • My car, my dog, my dishwasher… • Objects have ATTRIBUTES and METHODS Some attributes of a my dog Fido: • Color of fur = brown • Height = 20 cm • Owner’s Name = Ian • Weight = 2 Kg • Tail position = up Some methods of my dog Fido: • Bark • Walk • Run • Eat • Wag tail Fido

  42. What is a class? • A class is a type of object in the real world: • Cars, dogs, dishwashers… • Classes have ATTRIBUTES and METHODS Some attributes of a dog: • Color of fur • Height • Owner’s Name • Weight • Tail position Some methods of a dog: • Bark • Walk • Run • Eat • Wag tail The concept of a “dog”

  43. So an object is an instance of a class class The concept of “dog” object Fido

  44. Objects have unique names called “references” and classes have names too. class Dog object Class name Fido reference

  45. All classes have a method called new that is used to create objects. class Dog object Fido = new Dog(); Fido reference

  46. A reference to an object can be used to access its properties or methods. class Dog object print Fido->bark(); Fido woof

  47. A reference to an object can be used to access its properties or methods. class Bio::DB::RefSeq object $refseq = new Bio::DB::RefSeq; $refseq $molecule = $refseq->get_seq_by_acc(“NP_01014”); $molecule = Some sequence record

  48. Putting it all together So now that you understand (sort of)‏ Classes Objects Attributes and Methods What remains is learning what the different classes are that are available in BioPerl and what you can do with them. For the next exercise, use the documentation at bioperl.org* to figure out what the following code does… *see www.bioperl.org/wiki/HOWTOs and doc.bioperl.org (then click on bioperl-live)‏

  49. #! /usr/local/bin/perl # Create and run a program which creates a Seq object and manipulates it: use Bio::Seq; # initiation of Seq object $seq = Bio::Seq->new('-seq' =>'CGGCGTCTGGAACTCTATTTTAAGAACCTCTCAAAACGAAACAAGC', '-desc' => 'An example', '-display_id' => 'NM_005476', '-accession_number' => '6382074', '-moltype' => 'dna'); # sequence manipulations $aa = $seq -> moltype(); # one of 'dna','rna','protein' $ab = $seq -> subseq(5,10); # part of the sequence as string $ac = $seq -> revcom; # returns an object of the reverse complemented sequence $ac1 = $ac -> seq(); $ad = $seq -> translate; # returns an object of the sequence translation $ad1 = $ad -> seq(); $ae = $seq -> translate(undef,undef,1); # returns an object of the sequence translation (using frame 1) (0,1,2 can be used)‏ $ae1 = $ae -> seq(); print "Molecule Type: $aa\n"; print "Sequence from 5 to 10: $ab\n"; print "Reverse complemented sequence: $ac1\n"; print "Translated sequence: $ad1\n"; print "Translated sequence (using frame 1): $ae1\n"; Exercise16 Make the Bio::Seq class available to my program Create a new Bio::Seq object and initialize some attributes

  50. Exercise17 Check out the code of several examples using BioPerl at: • http://bip.weizmann.ac.il/course/prog2/perlBioinfo/

More Related