1 / 45

Selection and Enumeration of Low-Abundance Biological Cells from Complex Matrices

Selection and Enumeration of Low-Abundance Biological Cells from Complex Matrices. Udara Dharmasiri. Research Seminar April 19, 2010.

miranda-lopez
Download Presentation

Selection and Enumeration of Low-Abundance Biological Cells from Complex Matrices

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript

  1. Selection and Enumeration of Low-Abundance Biological Cells from Complex Matrices Udara Dharmasiri Research Seminar April 19, 2010

  2. “Highly Efficient Capture and Enumeration of Low Abundance Prostate Cancer Cells Using Prostate-Specific Membrane Antigen Aptamers Immobilized to a Polymeric Microfluidic Device” Electrophoresis, 2009, 30: 1-12 • “Microsystems for the Capture of Low-Abundance Cells” Annual Reviews of Analytical Chemistry, 2010, Vol. 3 • “Enrichment and Detection of Escherichia coli 0157:H7 Using An Antibody Modified Microfluidic Chip” Analytical Chemistry, 2010, 82 (7), 2844–2849 • “High-Throughput Isolation and Electrokinetic Manipulation of Circulating Tumor Cells Using a Polymeric Microfluidic Device” Manuscript in Preparation

  3. Highly Efficient Capture and Enumeration of Low Abundance Prostate Cancer Cells Using Prostate-Specific Membrane Antigen Aptamers Immobilized to a Polymeric Microfluidic Device Electrophoresis, 2009, 30: 1-12

  4. Clinical Utility of Circulating Tumor Cells (CTCs) • Cancer metastasis by circulating tumor cells (CTCs) • Elucidating the presence and number of CTCs is emerging as an effective method for www.metastasis.cauchoiscar.com - diagnosis - prognosis - prediction of therapeutic benefits Loeb, S. The oncologist 2008, 13, 299-305

  5. Analyzing Low Abundance Material from Peripheral Blood • Red Blood Cells • 109/mL • 3 – 5 µm • Biconcave discs 1 = CTC 2 = Membrane Pore 3 = Leukocyte • White Blood Cells • 106/mL • ~15 µm • Spherical • Circulating Tumor Cells • 1 – 10/mL • 15 – 30 µm • Spherical Hayes, D. F. J. et al. 2008, Clinical Cancer Res., 14, 3646-3650 Allard, W. J. et al. 2004, Clinical Cancer Res., 10, 6897-904

  6. Existing Tools for Analyzing CTCs in Peripheral Blood • Magnetic capture using microbeads coated with recognition elements • 5 log enrichment • Only mononucleated • cell fraction • 1 CTC in 106 MNC • Enumeration of cells by fluorescence visualization Dynal • Nuclear tracked polycarbonate membranes • Separation based on size • Requires whole blood density gradient centrifugation • 1 CTC in 1 mL of peripheral blood • Enumeration of cells by fluorescence visualization Vona et al., 2000, Am. J. Pathology 256: 57

  7. CTC-chip ●Made from silica using DRIE and contains microposts ●Target CTCs interact with antibody (EpCAM) coated microposts ●CTCs in the peripheral blood are captured and isolated ●Capture efficiency - ~65% ●Purity - ~50% ●Cell enumeration - by cell staining Nagrath, S. Nature 2007, 450, 1235-1239

  8. High Throughput Microsampling Unit (HTMSU) ●Selectively and specifically isolate breast cancer cells through a monoclonal antibody mediated process ●Sampling large input (1 ml) of whole blood in short time (<37 min) ●CTC capture efficiency >97% and purity ~100% ● The released CTCs enumerated on-device using conductivity detector with 100% detection efficiency Adams, A. A. JACS 2008, 130, 8633-8641

  9. Prostate Cancer ●Prostate cancer develops in the prostate gland ●The most common type of cancer in men in the USA ●Diagnosed by Prostate Specific Antigen (PSA) test - high false positive and negative errors (30%) www.prostatecancerfoundation.org ●LNCaP (Prostate cancer cell line) - Metastasize into the lymph nodes ●LNCaP cell membrane contains Prostate Specific Membrane Antigen (PSMA) PSMA - 750 amino acids - Mw = 110 kDa - 1 x 106 molecules/cell LNCaP Cells Liu, T.Prostate, 2008, 68, 955-964

  10. Aptamers for LNCaP Cell Capture NH2-(CH2)6-(CH2-CH2-O)6- CCAAGACCUGACUUCUAACUAAGUCUACGUUCC • Advantages • ● Chemically robust • ● Greater surface density • ● Properties can be changed on • demand • End-point attachment to surfaces ● Oligonucleotides ●Generated by in vitro selection process- SELEX PSMA Aptamer ●Mw = ~ 10 kDa and Kd = ~ 50 nM-1 Lupold, S. E. Cancer Res. 2002, 62, 4029-4033 Parrott, A.M Nuc. 2003, Acids Res. 28, 489-497

  11. Polymer-based High-Throughput Sampling Unit for Capturing CTCs (PMMA) • 150 µm (depth) x 30 µm (width) x 3 cm (length) • Total volume = 180 nL • Number of parallel channels = 51 • Processing time for 1 mL input (4 mm/s) = 9.1 min • 4-levels of specificity (capture – 30 µm; detection – 50 µm; immunoaffinity; shear) • Integrated reader for enumerating cells

  12. Production of Plastic Fluidic Components from Metal Molding Tools (2) • KERN MMP 2252 • Precision of ±1 µm • Microstructure aspect ratios ≤ 20:1 • Milling in metals, ceramics, polymers (3) (5) (6) 3) (1) CNC controller (2) 40,000 rpm spindle (3) Automated tool changer (4) Laser-based measurement system (5) Real-time imaging system (6) X-Y translational stage (4) (1)

  13. Producing Parts from Metal Molding Tools • Jenoptik Microtechnik HEX 02 • Attach mould insert • Evacuate chamber • Heat substrate to Tg • (105oC - PMMA) • Thermal fusion bonding for channel enclosure (2) (3) (4) 51-channel linear 20 μm linear (5) (1) (1) 35 μm linear (1) CNC controller (2)Telescopic upper stage (3)Lower heating platen (4)Fixed stage (5)Vacuum system 50 μm linear 51-channel curvilinear

  14. Immobilization of Aptamers to Polymer Surfaces 8.4 x 1012 molecules/cm2 Dharmasiri, U.R. Electrophoresis 2009, 30, 3289–3300 McCarley et al., J. Am. Chem. Soc. 2005, 127, 842-843

  15. Monitoring Fluidic Optimization Measurements Carl Zeiss Axiovert ● Computer controlled ● Programmable motorized stage ● Inverted optical microscope ● Video CCD inspection ● Fluorescence imaging

  16. Cell Capture Efficiency ●0.5 ml of 1,000 cells/ml suspension introduced at linear velocities between 0.1 to 10 mm/s ●Post capture rinse with 150 mM PBS at 50 mm/s linear velocity Capture determined by Encounter Rate (ko) ●The number of selected cells onto the PSMAaptamer and EpCAM antibody HTMSU counted using fluorescence microscopy Capture determined by reaction Probability (P) ■ Aptamer ■ Antibody Chang and Hammer, Biophys. J.,1999, 76, 1280 Dharmasiri, U.R. Electrophoresis 2009, 30, 3289–3300

  17. Non-Specific Cell Adsorption ●PSMA aptamer immobilized onto the HTMSU i) MCF-7 - Human breast cancer cell line, does not express PSMA ii) WBC - White blood cells iii) RBC - Red blood cells introduced at 2.5 mm/s linear flow velocity ● A post capture rinse performed with PBS buffer at 50 mm/s linear velocity ● The number of cells adsorbed onto the HTMSU counted using fluorescence microscopy ●PSMA aptamer does not interact with MCF-7, WBC and RBC Dharmasiri, U.R. Electrophoresis 2009, 30, 3289–3300

  18. Cell Release from the Capture Surface ● 0.25% (w/v) trypsin infused into the HTMSU ● Trypsin (23.8 KDa) – glycoprotein that proteolytically cleaves at arginine and lysine AA residues. pI = 10.5; Optimal activity at pH = 8.0 ● The process of typsination was evaluated by microscopy • Before trypsin infused • Exposed to trypsin for 2 min • Exposed to trypsin for 6.5 min - cell was released • Exposed to trypsin for 7.5 min - cell was removed Dharmasiri, U.R. Electrophoresis 2009, 30, 3289–3300

  19. Automated Cell Enumeration S N ≥3 Whole blood Whole blood + LNCaP • One ml of blood containing 20 LNCaP cells seeded into the HTMSU ● The captured cells released using the trypsin prior to on-chip conductivity enumeration ● Total of 18 cells were counted at a volume flow rate of 5 µl/min ● The conductance response from whole blood without LNCaP obtained Dharmasiri, U.R. Electrophoresis 2009, 30, 3289–3300

  20. Conclusions ●LNCaP cell capture efficiency for PSMA aptamer tethered microfluidic device was 95 +1% ● MCF-7 cells, WBCs and RBCs do not interfere with LNCaP cell capture and therefore cell separation purity is ~100% ● 0.25% (w/v) trypsin was an effective reagent for releasing LNCaP cells from the capture surface ● Conductivity enumeration efficiency was ~100% for the released LNCaP cells

  21. Enrichment and Detection of E. coli O157:H7 from Water Samples Using an Antibody Modified Microfluidic Chip Analytical Chemistry, 2010, 82 (7), 2844–2849

  22. E. coli O157:H7 • E. coli O157:H7 -gram negative bacterium • rod-shaped • 2 μm long and 0.5 μm diameter • The pathogenicity of E. coli O157:H7 is associated with the production of Shiga-like toxins • -bloody diarrhea • -colitis 2 m • In 2008, 2,000 Americans were hospitalized and • ~60 died (TC*- Total Coliform , FC*- Fecal Coliform) Alocilja, E.C. 2003. Biosens. Bioelectron. 18: 841-84

  23. # colonies x100 volume processed EPA Approved Method for E. coli Detection • ß-D glucuronidase production is not present in O157:H7 serotype • E. coli O157:H7 viable but not culturable • Presence of interfering agents alter the accuracy of chromogenic media 15 cfu/100mL 24 cfu/10mL 4 cfu/1mL CFU/100 mL Cell culturing using EPA Method 1603. (LSU-BR University Lake) Bennett, A.R. 1996. Letters in Applied Microbiology 22: 237-243

  24. Anti E.Coli O157:H7 Antibody • Mw = ~150 kDa • Polyclonal (pAb) • Kd = ~50 pM-1 • E. coli O157:H7 are identified by combination • of O and H antigens • 9×106 molecules of O antigen/bacteria www.kpl.com Microchip Enrichment (i) pAb can recognize O157 types for intact and non-culturable cells (ii) Selective cell capture allows cell enrichment and enumeration from potentially contaminated samples Fitzmaurice, J. Mol. Cell. Probes 2004, 18, 123-132

  25. 5.5 mm Polymer-Based (PMMA) Sampling Unit forE. coli O157:H7 Selection 11 mm 8 sub devices-16 curvilinear channels-9.5 mm long, 15 µm width/80 µm depth. Surface area (cell selection bed) = 40 mm2 , volume = 250 nL Dharmasiri U. R. Anal. Chem.2010, 82 (7), 2844–2849

  26. E. coli O157:H7 Selection and Enumeration 150 mM PBS solution infused at 50 mm/s linear velocity to remove non-specifically absorbed cells Dharmasiri U. R. Anal. Chem.2010, 82 (7), 2844–2849

  27. System Operation Carl Zeiss Axiovert 15 m Syringe pump • Inverted optical microscope • Fluorescence imaging with high sensitivity CCD • Syringe pump • E. coli cells were stained - FITC (PKH67) - Lipophilic membrane linker

  28. E. Coli O157:H7 Enumeration via RT-qPCR • PCR directed to the conserved regions within the genes encoding for SLT-I (shiga-like toxins) and the uidA gene, encodes for ß-glucuronidase in E. coli O157:H7 • Mismatch in G residue, as opposed to the T residue found in other E. coli strains) D Slt! 10 cfu Uid A 348 500 252 200 300 Threshold cycle (Ct) 6 cfu Log (cell density) [cfu] Recognition of Escherichia coli O157:H7 by mismatch amplification assay-multiplex PCR (Cebula et al.,1995, 33, 248)

  29. RT-qPCR Experiment Amplification and Dissociation Curves specific DNA product (80 oC) slt1 < 75°C correspond to non-specific DNA Fluorescence (dRn) Fluorescence (-Rn(T)) Ct Cycle # Temperature (oC) Real-time qPCR results for the uidA gene Dharmasiri U. R. Anal. Chem.2010, 82 (7), 2844–2849

  30. Cell Capture Efficiency Data for linear channel, depth- 80 m Data for curvilinear channel, width- 15 m and depth- 80 m Capture Efficiency (%) Capture Efficiency (%) Linear Flow Velocity (mm/s) Channel width (m) Chang/Hammer model for mobile cell interactions • Encounter rate • Probability of the reaction Dharmasiri U. R. Anal. Chem.2010, 82 (7), 2844–2849 • 3 x 103 cells/mL introduced at different volumetric flow rates • Total input volume analyzed = 500 µL Chang, K. C.; Hammer, D. A. Biophys. J. 1999, 76, 1280–1292

  31. Specificity of Polyclonal Anti-E. coli O157:H7 Antibody • 3x103 cells/mL were introduced at 5 mm/s linear velocity A micrograph of capture surface E. coli O157:H7 A micrograph of capture surface E. coli K12 15 µm Dharmasiri U. R. Anal. Chem.2010, 82 (7), 2844–2849

  32. Cell Release from the Capture Surface • Mixture of chelators infused into channels at 10 mm/s • Captured cells were observed microscopically until removed by release solution and Stoke’s force 4 min 0 min 0 min 4 min Avg. stripping time: 3.4 min +0.35 (n=25) • Brightfield micrograph of the captured cell before being infused the releasing solution • Fluorescent micrograph of the captured cell before being infused the releasing solution • Brightfield micrograph of the cell released surface (4 mins) • Fluorescent field micrograph of the cell released surface (4 mins) Dharmasiri U. R. Anal. Chem.2010, 82 (7), 2844–2849

  33. Water Sample Evaluation * Max Capacity of the bed: 260 x 106 cells LSU Lake Dharmasiri U. R. Anal. Chem.2010, 82 (7), 2844–2849

  34. Conclusions • Recovery of E. coli O157:H7was ~72% • E. coli O157:H7 was selected and enumerated without other serotype interferences • The strategy developed offered the ability to monitor recreational water quality without the need for a cell culture step • The entire processing steps were implemented in under 5 h

  35. High-Throughput Isolation and Electrokinetic Manipulation of Circulating Tumor Cells Using a Polymeric Microfluidic Device Future Work

  36. Objectives • Design a microfluidic device for processing 7.5 mL of blood to select CTCs in a short time period (~30 min) Allard, W.J. Clin. Cancer Res. 2004 10: 6897-904 • Electrokinetic collection of selected CTCs for molecular profiling

  37. Cell Selection and Manipulation

  38. High-Throughput Microsampling Unit (HTMSU) • Selectively and specifically isolate breast and prostate cancer cells through an affinity agent mediated process • Sampling 1 ml of whole blood in short time (<37 min) • CTC capture efficiency >97% and purity ~100% • The released CTCs enumerated on-device using conductivity detector with ~100% detection efficiency Adams, A. A. JACS 2008, 130, 8633-8641 Dharmasiri, U. Electrophoresis 2009, 30, 3289–3300

  39. Cell Capture Section of µHTMSU Out put In put  460 curvilinear channels  Volume -100 L  Process 7.5 mL of sample in 30 min

  40. Electrophoresis • Electrophoresis (EP): The force on a charged particle exerted by an electric field • Most mammalian cells are covered with negatively charged functional groups at neutral pH F = qE F - Coulomb force q- Net charge on the object E- The applied electric field • In water, the cells move at a velocity given by the balance of the Coulomb and viscous drag forces, a process known as EP Annu. Rev. Biomed. Eng. 2006. 8:425–54

  41. Electrokinetics • Utilizes the electroosmotic flow (eof) of the solution and the electrophoretic mobility (ep) of the material being transported • The linear velocity (app) at which the material moves is governed by; Vassar, P.S. Nature 1963, 4873, 1215-26

  42. Cell Manipulation Section of the Microfluidic Unit In put

  43. Future Directions • CTCs in large volume of patients’ blood (>7.5 mL) will be selected in short time (<30 min) • Molecular profiling of CTCs • Determine biology of CTCs and cells at primary tumor • Detection of point mutations • Gene expression profiling • Genetic Make up • Adhesion properties • Metastatic potential

  44. Acknowledgments Soper Research Group Prof. Steven A. Soper Prof. Robin McCarley Dr. Maggie Witek Dr. Robert Truax Ms. Karen National Science Foundation Grant NIH # - 1 R33 CA099246-01 State of Louisiana Board of Regents Texas Sea Grant (NA06OAR4170076)

  45. THANK YOU

More Related