1 / 13

Microsatellite Identification in the Thick-billed Parrot ( Rhynchopsitta pachyrhyncha )

Microsatellite Identification in the Thick-billed Parrot ( Rhynchopsitta pachyrhyncha ). By: Daniel Acosta Howard Hughes Medical Institute-NMSU Research Scholar Dr. Wright’s Lab Department of Biology. International Union for Conservation of Nature (IUCN 2007) World Parrot Trust

moke
Download Presentation

Microsatellite Identification in the Thick-billed Parrot ( Rhynchopsitta pachyrhyncha )

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript

  1. Microsatellite Identification in the Thick-billed Parrot (Rhynchopsitta pachyrhyncha) By: Daniel Acosta Howard Hughes Medical Institute-NMSU Research Scholar Dr. Wright’s Lab Department of Biology

  2. International Union for Conservation of Nature (IUCN 2007) World Parrot Trust Historic range: Southwestern United States and Northern Mexico (Snyder et. al., 1999) Habitat degradation and fragmentation from logging Thick-billed Parrot

  3. Range

  4. High degree of genetic variation to reduce the impact of founder effect, which may lead to genetic differentiation To adapt to a changing environment and to avoid reduced reproductive fitness. Importance to any translocation. Genetic Variation

  5. Microsatellites • Microsatellites are simple sequence repeats (1-6) base pairs long: e.g. GTGTGTGTGTGT or ACGACGACGACGACGACGACG found in the genome of both prokaryotic and eukaryotic organisms • Found in coding and non-coding regions • They have a high mutation rate and high variability in natural populations. • High degree of polymorphism • All of these characteristics makes microsatellites a class of genetic marker that is highly useful to assess genetic variation.

  6. Boil clone in TE buffer Genetic Library Methods: Isolation of Microsatellites DNA Extraction PCR T3/T7 T3/T7/GT10 (Kongrit et. al., 2008) (Zane et. al. 2002)

  7. Methods: Primer Design Primer Design Sequencing CCGAGTAGGACAGAGCCTTGGGTGGCATGGTTTAGTGGGAGGTGTCCCTGCCCACGGCATGGGGTTTGGAACTAGATGATCTTAAGGTCCTTTACAGCCCTAACTGTTCTATGATTCTATTGGGTCTCAAGGGTTTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTTCATTTTCCTCTTCAGGGTGGA ATAAGAGCCTTGAATTACAACATTAAACCTTTTAAATGG Test for amplification in thick-billed parrot DNA Optimize Primers Polymorphism

  8. Polymorphism • Having genetic diversity • Proportion of loci polymorphic: Number of polymorphic loci / total number of loci sampled • We can also calculate allelic diversity: If we have sampled 6 loci and the diversity is as follows (1, 3, 3, 2, 2, 3) Allelic diversity=(1+3+3+2+2+1) / 6 = 2 • These calculations tell us a great deal about the genetic variation of the target population

  9. Up to date: 3 primers we designed and 4 designed for other species. These primers have been optimized for [Mg] and annealing temperature. We now propose to use these primers to assess the genetic variation not only of the wild population, but of the captive population. Compare wild population to captive population Progress and Future Goals

  10. Acknowledgements • Howard Hughes Medical Institute-NMSU Research Program • Dr. Timothy Wright • Ph. D Student Erin Schirtzinger • Ph. D Student Swati Mukherjee • Ph. D Student Alejandro Salinas • Nadine Lamberski @ San Diego Zoo • Kari L. Schmidt. @ American Museum of Natural History

  11. References IUCN 2007. Rhynchopsitta pachyrhyncha. <http://www.iucnredlist.org/search/details.php/19715/all> (March 26, 2 008 2007). Kongrit, C. et. at. (2008). Isolation and characterization of dinucleotide microsatellite loci in the Asian elephant (Elephas maximus). Molecular Ecology8, 175-177 Snyder, N. F. R., E. C. Enkerlin-Hoeflich, and M. A. Cruz-Neto. 1999. Thick-billed Parrot (Rhynchopsitta pachyrhyncha) The Birds of North America 24 Zane, L., Bargelloni, L., & Patarnello, T. (2002). Strategies for microsatellite isolation: a review. Molecular Ecology 11, 1-16g

  12. Picture Sources • http://www.avianweb.com/images/birds/parrots/thickbilledparrots/thickbilled.jpg • (map) http://content.cdlib.org/xtf/data/13030/xw/ft0f59n6xw/figures/ft0f59n6xw_00001.gif • http://www.aviary.org/~aviary/images/thick-billed%20parrots.jpg • http://www.dkimages.com/discover/previews/928/55058803.JPG • http://www.sabo.org/images/tbpanest.jpg • http://www.expeditionswest.com/adventures/2004/sierra_madre/JourneyOneSatevo/images/DSCF3627.jpg

  13. Questions??

More Related