Warm-Up / EOC Prep

1. Warm-Up / EOC Prep 1. Mr. Jones has extremely long legs and Mrs. Jones is heterozygous for extremely short legs. If extremely short legs are dominant over extremely long legs, what percentage of the offspring will have short legs? A. 100% short, 0% long B. 75% short, 25% long C. 50% short, 50% long D. 25% short, 75% long 2. If two parents are homozygous for a genetically inherited recessive trait, what is the probability that they will have a child who does not have this trait in his or her phenotype? A. 0% B. 25% C. 50% D. 100% Just draw boxes and answers.

2. Agenda • Warm-up • Notes • Practice multiple choice questions • Finish Vocab Matching • Jeopardy • Clean-up • Cool-down

3. TOMORROW- GENETICS EXAM.

4. DNA REVIEW

5. Structure of DNA was discovered in the 1950’s by Watson and Crick in England. They were able to determine the structure of DNA as a double helix by stealing a photograph of work done by Rosalind Franklin.

6. DNA is made up of subunits called nucleotides. A nucleotide is made up of three parts: A sugar, A phosphate and A nitrogen base. The sugar in DNA is called deoxyribose.

7. The four nitrogen bases in DNA are: adenine, cytosine, guanine and thymine. DNA has base pairing rules: Adenine always pairs with Thymine and Guanine always pairs with Cytosine.

8. What is the complementary DNA strand? • TACAGTCTAGGCATCCAGCAT • ATGTCAGATCCGTAGGTCGTA

9. DNA replication is the process by which DNA makes an exact copy of itself prior to cell division.

10. 1. DNA double helix unwinds. • 2. DNA strand is unzipped between the nitrogen bases. The point at which it is unzipping is called the replication fork.

11. 3. DNA Polymerase adds nucleotides to each side of the original DNA strand. • 4. When DNA Polymerase reaches the ends of the strands, two identical copies of the DNA have been made. • 5. Each new strands winds back up into the double helix structure.

12. There are three main differences between DNA and RNA: • 1. RNA has the sugar Ribose / DNA has the sugar Deoxyribose. • 2. RNA is single stranded / DNA is double stranded. • 3. In RNA, adenine pairs with uracil / in DNA, adenine pairs with thymine.

13. There are three types of RNA: 1. messenger RNA (mRNA) – carries message from DNA in the nucleus to the ribosome for protein synthesis.

14. 2. transfer RNA (tRNA) – brings amino acids to the ribosome for protein synthesis. • 3. ribosomal RNA (rRNA) – makes up the structure of the ribosome.

16. Protein synthesis is broken down into two processes: transcription and translation. • Transcription occurs in the nucleus. It is the process of making mRNA from DNA.

17. Transcribe the following DNA segment: • TACAGTCTAGGC ATCC AGCAT AUGUCAGAUCCGUAGGUCGUA

18. Translation occurs in the cytoplasm at the ribosome. It is the process of making a protein from the mRNA.

20. The ribosome reads the mRNA 3 nucleotides at a time (a codon). A tRNA molecule brings the correct aminoacid to the ribosome based on its anti-codon. The ribosome continues adding amino acids until it reaches a “stop” codon. It then releases the protein and begins again.

21. Break the mRNA segment from above into codons: • AUG UCA GAU CCG UAG GUC GUA • What are the correct tRNA anti-codons? •   UAC AGU CUA GGC AUC CAG CAU • What is the amino acid sequence for the protein? • Met Ser Asp Pro Stop Val Val

23. A mutation is any change in a DNA sequence. These changes can result in the wrong sequence of amino acids in a protein – which will cause the protein to function incorrectly.

24. 1. insertion – an extra nucleotide is added to the sequence. 2. deletion – a nucleotide is removed from the sequence. 3. inversion – a sequence of nucleotides is switched. 4. duplication – a nucleotide or sequence of nucleotides is repeated. 5. substitution – a nucleotide is replaced with a different nucleotide.

25. DNA Fingerprinting – separates DNA into segments and moves them through a gel to create a banding pattern. This pattern of bands is compared to crime scene DNA or parental DNA to determine guilt or paternity.

26. Cloning – the process of creating genetically identical individuals from a parent cell.

27. Recombinant DNA – A gene is removed from a human chromosome and inserted into bacterial DNA. This programs the DNA in the bacteria to produce the chemicals that the gene is for (ex. insulin). This creates safer and more cost effective treatment for many diseases (ex. diabetes).

28. Restriction Enzymes – cut DNA sequences between specific base patterns (ex. GGCC or TATA). • Transgenic Organism – an organism with DNA from another species.

29. Human Genome Project – scientists have worked to map the location of every gene in the human genome. They have identified many genes that can lead to diseases and are working on potential therapies and cures for these diseases.

30. Genetics Review Questions #1, #2 & #3 • 10 minutes- complete them on your own first • 10 minutes- discuss with your table partner and decide on an answer • 5 minutes- which ones were hard and why?

32. Do you have to study for the test? YES When is the test? Thursday! What can I do to study? Make flashcards, study with a friend, read the study guide, memorize the study guide, do practice problems

33. Warm-Up / EOC Prep 1. Two tall pea plants have some offspring that are tall (T) and some that are short (t). The genotypes of the parents are probably… A. TT and TT B. Tt and Tt C. TT and tt D. TT and Tt 2. If all of the sons of a normal male have hemophilia, a sex-linked disorder, and all of their daughters are carriers, what must be true about his wife?  A. Her father was normal B. She is a carrier C. She has hemophilia D. Her mother was normal

34. Agenda • Warm-up • Review • Genetics Test • Clean-up • Cool-down