NAS Summer Institute 2010

1. NAS Summer Institute 2010 Sassy Group 6: Gene Expression I Harvard University Tamara Brenner, Briana Burton, Robert Lue University of California, Davis Samantha Harris, Mitchell Singer University of Iowa Brenda Leicht, Bryant McAllister University of MinnesotaRobin Wright (Facilitator) University of Colorado, Boulder Katie Chapman (Consultant)

2. Bryant Mitch Rob Brenda Briana Samantha Tamara Katie NAS Summer Institute 2010 Sassy Group 6: Gene Expression I

3. Sassy Group 6 Gene Expression I Brenda, Briana, Bryant, Katie, Mitch, Rob, Samantha, TamaraAnd Robin NAS Summer Institute June 25, 2010

4. Differential Regulation of Gene Expression Determines Cell Form and Function Level Introductory Genetics Introductory Biology (late in the course) Knowledge of students prior to this unit Know gene structure Know the basic steps of the central dogma and relevant techniques

6. The Teachable Tidbit Provides a hands-on activity for students to identify and examine transcription factor binding sequences, and evaluate the effect of variations in these sequences.

7. Forming a Consensus with Tidbits

8. Forming a Consensus

9. Blasts from the Recent Past RNA polymerase transcribes DNA into RNA HHMI Biointeractive

10. Blasts from the Recent Past DNA-binding proteins initiate transcription Drew Berry/HHMI

11. Different base pairs present different patterns of hydrogen bond donors and acceptors Blasts from the Recent Past adapted from Alberts et al

12. "Wanna talk about development? Of a single cell into a gentleman?" "Proteins and DNA? Some interesting chemistry. Cuz they gettin jiggy with some different affinities." www.youtube.com/user/tomcfad

13. SRY SRY Genetic Control of Differences Between Females & Males

14. Chromatin Immunoprecipitation on Microarrays (ChIP-on-chip):a method to identify the DNA-binding sites of a specific transcription factor en.wikipedia.org/wiki/File:ChIP-on-chip_wet-lab.png

15. Group Activity:Identify the binding site for SRY You are playing the roles of spots on a microarray chip. You are all 21-mer nucleotide sequences discovered in this SRY ChIP-on-chip experiment.Compare your sequence with others at your table and identify a series of nucleotides in common.Come to a consensus on the nucleotide sequence recognized by SRY. TAAACGAAGGTAAACAATAGA GCGCGCAACAATCCCGGGTTT

16. TAAACGAAGGTAAACAATAGA TTCTTAACTAACAAACGCGAT CCGTTTCACAACTATACTACT AACAATAAGGCGACGCCTCTC GCGCGCAACAATCCCGGGTTT TACTTGATGGCAAACAATATA TCGTTACGTAACAAACTCCAT GGGTTTGACAACTATGCAATT AACAATGAGGCGTTTTATCAC AAGTGCAACAATAAGCCCTCT

17. TATAGGAAGCTAAACAATAGA CCCTTAGCTAACTAACGCTAT CTTTATGGCAACTATACTACT AACAATACGGTTACGCCTATC GGGCGCAACAATCACGGGTAT

18. Consensus AACAAT most common AACTAT (-1) AACAAA(-1) AACTAA (-2) Clicking for Data:Forming a Consensus Use your clicker to indicate the SRY binding site in your sequence. A: AACTAT B: AACAAT C: AACAAA D: AACTAA

19. Consensus Group Discussion:Forming a Consensus

20. Group Discussion Groups 1 and 2 Propose reasons why some sequences in your experiment are more common than others. Groups 3 and 4 Is it significant that these sequences have identical nucleotides at certain positions but not at others? Defend your answer. Groups 5 and 7 Predict the sequences to which the transcription factor binds most strongly. How did you arrive at this conclusion?

21. http://www.picturingtolearn.org

22. Express and assess your understanding through pictures

23. Picturing to Learn In-Class Activity On a piece of paper you are going to create a freehand drawing to explain the following to a high school senior taking biology: How the degree of match with a consensus sequence can affect the binding affinity of a transcription factor and the subsequent level of gene expression. Before you begin to draw, please think about the following: if you were evaluating your drawing, what are the 3 most important scientific components/concepts/ideas that need to be included in your visual representation in order to explain the science to your target audience? The most important should be at the top. Use a blank page to create your drawing. It should contain all the necessary information you indicated above. Your audience will not see your list, so your drawing should include some labels and brief captions. 23

24. Back to SRY (Sex determining Region Y Gene) SRY is a transcription factor that regulates genes needed for development of male-specific structures (e.g., testes) and male-specific traits -SRY +SRY -SRY +SRY bio.miami.edu

25. SRY protein binds DNA at the sequence 5’-ATAACAAT-3’ and bends the DNA in that region to change the openness of chromatin.

26. Mutations in SRY or its Target Genes • SRY Mutations • Cause of 10-15% of cases of 46(X,Y) gonadal dysgenesis • Some of these are nonsense or frameshift mutations that lead to nonfunctional protein • Many are missense mutations that affect the DNA binding ability of the SRY protein. • Target Genes • MOA-A; altered expression is implicated in several neuropsychiatric disorders including depression, autism and ADHD, which differ in incidence between males and females.

27. Homework A group of Russian scientists, Savinkova et al (2008), identified changes in the TATA box of human promoters that lead to distinct pathologies. Some of the mutations and resulting phenotypes are listed below. Savinkova, L.K., et al: Biochemistry (Moscow) 2009, 74(2): 117-129.

28. Homework 1. Make a drawing that explains why some changes in the TATA box lead to a decrease in protein expression, while others lead to an increase in protein expression. 2. Imagine that you identify individuals with the mutation in the β-Globin promoter that is listed in the table. However, these individuals express normal levels of β-globin protein and are not affected by β-thalassemia. It turns out that these individuals have additional mutations in their DNA. What possible mutation(s) could explain why these individuals do not express the disease?

30. 30