1 / 1

...atcgag gcttctc... ...tagctccgg agag...

pJL 43 vector MCS. atcgaggccagaagagcaacctttacgtactt gctcttc agcttctc tagctccggt cttctcg ttggaaatgcatgaacgagaagtcgaagag. I. Combine SapI Digested pJL 43 with PCR product. ...atcgag gcttctc... ...tagctccgg agag. ggcctt-PCR Product-aagc

neva
Download Presentation

...atcgag gcttctc... ...tagctccgg agag...

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript

  1. pJL 43 vector MCS atcgaggccagaagagcaacctttacgtacttgctcttcagcttctc tagctccggtcttctcgttggaaatgcatgaacgagaagtcgaagag I. Combine SapI Digested pJL 43 with PCR product. ...atcgag gcttctc... ...tagctccgg agag... ggcctt-PCR Product-aagc ccggaa-PCR Product-ttcg II. T4 DNA Pol + dATP/dTTP + DNA Ligase ...atcga gcttctc... ...tagctccgg aagag... ggcctt-PCR Product-aa aa-PCR Product-ttcg III. Final ligated product ...atcgaggcctt-PCR Product-aagcttctc... ...tagctccggaa-PCR product-ttcgaagag...

More Related