Genomics & Medicine http://biochem158.stanford.edu/

1. Genomics & Medicinehttp://biochem158.stanford.edu/ Simple Nucleotide Polymorphisms http://biochem158.stanford.edu/SNPs.html Doug Brutlag Professor Emeritus of Biochemistry & Medicine Stanford University School of Medicine

2. The Genome is Out of the Baghttp://stanmed.stanford.edu/2010fall/article1.html

3. Human Genetic Variation2007 Scientific Breakthrough of the Year Simple Individual 1 Individual 2 Individual 3 Individual 4

4. Simple (or Single) Nucleotide Polymorphisms (SNPs) • SNPs are common variations which occur at > 15 million positions in human genome • SNP MAF frequency can vary from 50% to 0.1% of population • SNPS can serve as genetic markers • SNPs can be used for identifying individuals and forensics • SNPs are used for mapping & genome-wide association studies of complex disease • SNPs are used for ancestry tracking & family relationships • SNPs are used for estimating predisposition to disease • SNPs are associated with disease, usually do not cause them • SNPs are used to predict risk of common genetic diseases • SNPs are used for personalized medicine and genomics • SNPs are used for classifying patients in clinical trials GCTGTATGACTAGAAGATCGAT GCTGTATGACGAGAAGATCGAT

5. SNPs and Mutationsin the Human Genome • 15 million sites in the human genome where SNPs can occur • 3.8 million SNP sites cataloged in 270 individuals in the HapMap consortium • Another 11 million SNP sites cataloged in the 1000 Genome effort • 10 million sites are common (minor allele frequency: MAF > 5%) • Each individual has 3-5 million SNPs (common variations) relative to the reference human genome • Each individual also carries 300 to 500 rare mutations (more recent) many of which are lethal

6. A SNP Primer at NCBIhttp://www.ncbi.nlm.nih.gov/About/primer/snps.html

7. Department of Energy (DOE) SNP Pagehttp://www.ornl.gov/sci/techresources/Human_Genome/faq/snps.shtml

8. A Primer of Genome ScienceChapter 3 Genomic Variation

9. Simple Nucleotide Polymorphisms (SNPs) • SNPs are common variations in the genome (minor allele frequency or MAF between 50% and 1%) • Most SNPs are genetically neutral • Used in DNA fingerprints - forensics • Paternity tests • Immigration in the United Kingdom • Used to track ethnic migrations and ancestry • Some SNPs reflect distinguishing characteristics • Often the basis for racial & genetic discrimination or other stigma • Rarer variations cause disease. Unlike SNPs, these variations are rare, often called mutations. • Some SNPs linked to predisposition to disease • SNPs can serve as genetic markers for other traits • Clinical trials associate SNPs with drug efficacy • Clinical trials associate SNPs adverse drug reactions • Personal genomics associate SNPs with traits • 23andMe, Navigenics, DNADirect

10. Types of SNPshttp://www.ncbi.nlm.nih.gov/sites/entrez?db=snp • Non protein coding SNPs • Promoters • 5’ UTR • 3’ UTR • Introns • Intergenic Regions • Pseudogenes • Regulatory • Splicing • Transcriptional regulation (promoter & transcription factor binding sites) • Translational regulation (initiation or termination) • Regulatory miRNA target sites • Coding SNPs • Synonymous SNPs (third position variation) • Replacement SNPs (change Amino acid) • Functional SNPs (acceptable amino acid replacement) • Non-functional SNPs (traits & diseases)

11. Human Promoter SNPs © Gibson & Muse, A Primer of Genome Science

12. dbSNP at NCBIhttp://www.ncbi.nlm.nih.gov/SNP/

13. Human β-Hemoglobin Genehttp://www.ncbi.nlm.nih.gov/gene/3043

14. Human β-Hemoglobin Genehttp://www.ncbi.nlm.nih.gov/gene/3043

15. Human β-Hemoglobin Gene SNPshttp://www.ncbi.nlm.nih.gov/SNP/snp_ref.cgi?locusId=3043

16. β-Hemoglobin Gene SNP rs111645889http://www.ncbi.nlm.nih.gov/SNP/snp_ref.cgi?rs=111645889

17. β-Hemoglobin Gene SNP rs111645889http://www.ncbi.nlm.nih.gov/SNP/snp_ref.cgi?rs=111645889

18. β-Hemoglobin SNP Variation Viewerhttp://www.ncbi.nlm.nih.gov/sites/varvu?gene=3043

19. Origin of Haplotypes © Gibson & Muse, A Primer of Genome Science

20. Linkage Disequilibrium and Recombination Rate © Gibson & Muse, A Primer of Genome Science

21. Linkage Disequilibrium (LD) Across the Human LPL Gene © Gibson & Muse, A Primer of Genome Science

22. Recombination hotspots are widespread and account for linkage disequilibrium structure 7q21 © Gibson & Muse, A Primer of Genome Science

23. Consensus binding site for PRDM9

24. Recombination hotspots are widespread and account for linkage disequilibrium structure

25. Recombination hotspots are widespread and account for linkage disequilibrium structure 7q21 © Gibson & Muse, A Primer of Genome Science

26. Observation of Haplotypes Individual 1 Individual 2 Individual 3 Individual 4 © Gibson & Muse, A Primer of Genome Science

27. SNPs in Populations © Gibson & Muse, A Primer of Genome Science

28. Sequence and Distance-Based Phylogenies (evolutionary trees) • Sequence-Based Methods (Parsimony) • Assigns mutations to branches • Minimize number of changes • Topology maximizes similarity of neighboring leaves • Distance-based methods • Branch lengths = D(i,j)/2 for sequences i, j • Distances must be metric • Distances can reflect time or number of changes • Distances must be relatively constant per unit branch length

29. A Haplotype Map of the Human Genomehttp://www.nature.com/nature/journal/v437/n7063/full/nature04226.html © Francis Collins, 2008

30. International HapMap Projecthttp://www.hapmap.org/

31. Thousand Genomes Projecthttp://www.1000genomes.org/

32. 10,000 Genomes Project Evolutionary Biologyhttp://www.genome.gov/

33. National Human Genome Research Institutehttp://www.genome.gov/