Chapter eleven RNA transcription

1. Chapter eleven RNA transcription

2. DNAs RNAsProteins 1 3 2 1 1 DNA replication: entirety 2 RNA transcription: systematicness 3 protein biosynthesis: individuality

3. Concept of RNA biosynthesis or Gene transcription  The transmission of the genetic infor- mations is fromDNA to RNA. Transcription is the synthesis of a single- stranded RNA from DNA template.  RNA synthesis occurs in the 5’3’ direction. Transcription is asymmetry.

4. Section 1 template and enzymes in RNA biosynthesis

5. coding strand* positive strand Crick strand antisense strand 3’ 5’ GTAC CATG 3’ 5’ GUAC 3’ sense strand 5’ Watson strand new RNA strand negative strand template strand*

6. transcriptional template template 5’ 3’ 3’ 5’ 3’ 5’ 5’ 3’ 5’ 3’ 5’ 3’ It is the fragments of gDNA. It is only one of double-strand DNA, therefore, transcription is asymmetric.

7. types of genes in gDNA 5’ 3’ mRNA gene rRNA gene spacer tRNA gene other RNA gene 3’ 5’

8. RNA polymerase in E.coli  molecular weight:480kd  consists of 2’

9. The function of subunits of RNA polymerase in E. coli determines which genes are transcribed  catalytic site ’ binds DNA template  recognizes transcription initiationsite

10. annotation  The 2’ complex is core enzyme in RNA polymerase  The 2’ complex is holoenzyme of RNA polymerase

11. RNA polymeras in eukaryote variety transcripts respond to amanitin Ⅰ 45s-rRNAresistant (28S, 18S, 5.8S) Ⅱ* hnRNA(mRNA)very sensitive Ⅲ 5s-rRNA midding tRNA,snRNA sensitive

12. 3’ • There is some sequence, which is recognized and bound by RNA polymerase, on 5’ end of transcriptional genes. • characters of the sequence • There are many A-T pairs • There are some consensus sequence gene   +  ’ 5’

13. The binding region 5’ gene termination signal 5’ -50 -40 -30 -20 -10 1 10 transcribed initiation site promoter site

14. In prokaryotes promoter 40-80bp 5’ 2 3 1 -50 -40 -30 -20 -10 1 10 gene transcribed initiation site TATAATPu ATATTAPy TTGACA AACTGT Binding site Pribnow box Recognition site

15. In eukaryotes promoter 5’ -50 -40 -30 -20 -10 1 10 gene GC box CAAT box TATA box Hogness box

16. Ⅲ Ⅰand Ⅱ gene 5’ 5’ 5’ 5’ 5’ + + gene+promoter RNA pol I or II promoter RNA polIII 5’ 5’ 5’

17. terminator DNA 5’…GCCGCCAGTTCGGCTGGCGGCATTTT… 3’ RNA 5’…GCCGCCAGUUCGGCUGGCGGCAUUUU…3’ C • The signals that terminates transcri-ption are localized in the gene 3’ end. • A simple termination signal is a GC- rich region that is a palindrome, followed by AT-rich sequence. • The RNA made from the DNA palindrome is self-complementary and so formed a internal hairpin structure followed by a few U bases. G U U G G AC C G C C G C UG G C G G C 5’ A U U U U-OH 3’

18. Section 2 Process of RNA biosynthesis 1. initiation 2. elongation 3. termination

19. process of transcription in prokaryote ’  1 5’ 5’ 5’ 5’ 5’ 5’ 5’ 5’ 2 3 4 5 5’ pppG 5’ pppGN 6   5’ pppG 7 5’ pppG mRNA

20. coding strand P~P~P O P~P~P O H CH2 template strand O H 3’ 3’ CH2 5’ 5’ H H O O O H H H G O OH PPi H C C -O P O G OH OH P~P~P O O H CH2 H CH2 O O H H H H O O H H A OH OH A OH OH T T 5’ 5’ 3’ 3’

21. transcription bubble direction of transcription RNA polymerase coding strand unwinding 5’ RNA-DNA hybrid 5’ rewinding 5’ pppG New RNA strand template strand 17bp

22. transcription in prokaryote under electromicroscope 5’ 1 5’ 2 1 5’ 3 2 1 5’ 4 3 2 1 5’ 5 4 3 2 1

23. termination of gene transcription in prokaryote 1. Dependent upon  factor RNA polymerase Promoter Terminator Gene 5’ 5’ c c c c c c c c c c   new RNA

24.  factor function:  It can bind with polyC in RNA 3’end.  It has activity of ATPase and helicase.  It may denature short RNA-DNA hybrid double strands.

25. 2. Independent to  factor: The base sequence and transcript RNA secondary structure of rplL gene 3’ end in E. coli. TTGCAGCCTGAGAAATCAGGCTGATGGCTGGTGACTTTTTAGTCACCAGCCTTTTT or UUUUU UUUUU

26. model about transcription termination for independent to  factor RNA polymerase coding strand 5’ 5’ 5’ template strand new RNA transcript

27. Section 3 post-transcriptional processing of eucaryotes 1. Process after transcription for mRNA 2. Process after transcription for tRNA 3. Process after transcription for rRNA

28. Process after transcription for mRNA 1. Capping of mRNA 5’-end 2. polyadenylation of mRNA 3’-end 3. splicing of mRNA

29. hnRNA Capping of 5’-end 5’pppG phosphatase PPi 5’ pG pppG G 5’ ppp 5’ G methylase m7G 5’ppp 5’m2’G

30. Explanation 1. It is carried out in nuclear. 2. It is earlier than the splicing . 3. It relates with protein translation . 4. It can protect mRNA 5’-terminal from nuclease. 5. The mRNA 5’-terminal of prokaryote doesn’t have the capping structure.

31. modification and termination of transcription about eukaryotegene RNA polymerase coding strand 5’ AATAAA GTGTGT modification point TTATTT CACACA 5’ 5’ GUGUGU AAUAAA template strand new RNA strand AAA AAA polyA tail 5’ AAA AAA

32. Explanation 1. The polyA tail is independent on DNA template. 2. It is also carried out in nuclear. 3. It is also earlier than the splicing . 4. It can protect mRNA 3’-terminal from nuclease. 5. The mRNA 3’-terminal of prokaryote doesn’t have the polyA tail structure. 6. It relates with protein translation .

33. CH3 O N N 7 O- H 5’ N N H2N H2C O O P O O O- O P OH OH O O- O P O N 5’ CH2 O O OCH3 ……AAAAAAAA-OH P O O O-

34. exon-2 exon-3 exon-4 intron-2 intron-1 intron-3 exon-1 5’ DNA double strand split gene hnRNA strand 5’ splicing enzyme mRNA splicing of hnRNA

35. hnRNA strand lariat structure 5’ mRNA

36. transcription and past-transcribed modification for albumin gene L 1 2 3 4 5 6 7 5’ gene-7.7kb A B C D E F G 47 185 51 129 118 143 156 1043 transcription hnRNA 5’ modification modified mRNA 5’ AAA AAA m7G5’ppp5’ m2’G to form lariat 5’ m7G5’ppp5’ m2’G lariat mRNA AAA AAA splicing 5’ AAA AAA m7G5’ppp5’ m2’G mature mRNA

37. U1-snRNA U2-snRNA PPPGm UCCAUACAUAPPPGm AUGAUGU AG……. UACUACA ….....AGGUAUGU exon-1 exon-2 pG-O-H intron-1

38. kinds of introns and its way of splicing 1. It is in the rRNA gene mainly. self-splicing RNA=ribozyme 2. It is in the protein-coding gene of mitochondrion and chloroplast. 3. It is in the most protein coding gene. lariat way, by small nuclear ribonucleoprotein 4. It’s in the tRNA gene. requires enzyme and ATP

39. What is the functions of introns in gene?

40. Process after transcription for tRNA 1. Splicing . 2. To form rare base. 3. Addition of 3’-terminal CCA-OH.

41. 3’ OH U U 3’ OH U U 5’ spliced tRNA 5’ 5’ primary transcript tRNA gene splicing of primary transcript for tyrosine-tRNA in yeast

42. 1. methylation: catalyzed by tRNA-methyltransferase, A Am, G Gm, C C m 3’ OH U U 3’ OH U U spliced tRNA 5’ 5’ A Am Cm C G Gm G Gm G Gm to form rare base in transcript of tyrosine-tRNA in yeast

43. to form rare base in transcript of tyrosine-tRNA in yeast 2. U reduction: U DHU(D) 3’ OH U U 3’ OH U U 5’ 5’ Am Am Cm Cm D D U Gm Gm U D Gm Gm D D U U Gm Gm U

44. 3’ OH U U 3’ OH U U 5’ 5’ Am Am  Cm Cm D U D U Gm Gm U D Gm Gm D D U U Gm Gm U  U to form rare base in transcript of tyrosine-tRNA in yeast 3. translocation in nucleoside:U

45. to form rare base in tRNA 4. deamination Don’t have for tyrosine-tRNA in yeast. For other aminoacyl-tRNA, A I

46. 3’ OH A C C 3’ OH A C C 3’ OH U U 3’ OH U U 3’ OH U U nucleotide transferase 5’ 5’ 5’ Am Am Am    Cm Cm Cm D D D D D D Gm Gm Gm D D D Gm Gm Gm D D D D D D Gm Gm Gm    Addition of 3’-terminal CCA-OH of tyrosine-tRNA in yeast

47. 3’ OH A C C cloverleaf pattern:secondary structure mature tyrosine tRNA in yeast amino acid arm 5’ T loop Am DHU loop C T Cm C  D D Gm Gm Gm D D D anticodon loop extra loop  A G U

48. process after transcription for rRNA tandem repeated gene spacer spacer spacer 18S 5.8S 28S 45 S

49. Explanation 1. In eukaryotic cell the rRNA gene is redundant gene, which arranges on chromosome by tandem. 2. All eukaryote have 18s, 5.8s and 28s rRNA. 3. The rRNA gene is located in nucleolus. 4. The rRNA is spliced by ribozyme. 5. The ribozyme is self-splicing RNA.

50. The structure of ribozyme loop catalytic point consensus sequence 5’ 3’ stem