1 / 4

Nelson, PT_Suppl_Fig2

Nelson, PT_Suppl_Fig2. A. B. Nelson, PT_Suppl_Fig3. Lysate Co-IP after transfections. *. **. **. GRN. GRN. BACE1. BACE1. n=3 biological replicates each MiR-107 v NEG-CTRL *-p<0.01; **-p<0.0001. Nelson, PT_Suppl_Fig4. A. 13 miR-107* 35

odette
Download Presentation

Nelson, PT_Suppl_Fig2

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript

  1. Nelson, PT_Suppl_Fig2 A B

  2. Nelson, PT_Suppl_Fig3 Lysate Co-IP after transfections * ** ** GRN GRN BACE1 BACE1 n=3 biological replicates each MiR-107 v NEG-CTRL *-p<0.01; **-p<0.0001

  3. Nelson, PT_Suppl_Fig4 A 13 miR-107* 35 c c --c uuc u a ucu ugcuuu agcucuuacaguguugcuug ggc u ||| |||||| |||| || ||||||||||| ||| ||| g aga acgaaa ucgg ga auguuacgacg aac uug g c cua - c - - a 72 miR-107 50 5’ 3’ Homo sapiens miR-107 stem-loop B u u c agcu cu uacaguguugc uugmiR-107* |||| || ||||||||||| | ucgg ga auguuacgacg a miR-107 acua - c- 5’ 3’ 5’ 3’ miR-107 duplex for transfection D C Anti-AGO co-IP with downstream qPCR

  4. Nelson, PT_Suppl_Fig5 Y axis: # miR-16 seed sequences/1000 nts in 5’utr, CDS, and 3’UTR A X axis: miR-16 targets sorted by enrichment in AGO co-IP (50 mRNAs/grp) 1 1000 2000 3000 B X axis: miR-16 targets sorted by mRNA lysate “knock-down” (50 mRNAs/grp) 1 1000 2000 3000

More Related