1 / 11

Team Conoscenza

Team Conoscenza. Bioinformatics. Tan Jian Wei ~ Tan Fengnan. Presentation Flow. Background Problem Solution Technical Difficulties Milestones Questions. Background. Human Genome Project Began 1990 – Ended at 2004 Mapped out all of the Human Genome Sequences

Download Presentation

Team Conoscenza

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript


  1. Team Conoscenza Bioinformatics Tan Jian Wei ~ Tan Fengnan

  2. Presentation Flow • Background • Problem • Solution • Technical Difficulties • Milestones • Questions

  3. Background • Human Genome Project • Began 1990 – Ended at 2004 • Mapped out all of the Human Genome Sequences • 20,000 – 25,000 “working” gene • 3.3 Billion base pairs • Adenine, Thymine, Guanine, Cytosine • The base pairs will form proteins or hormones after a process known as “Transcription” Background Problem Solution Technical Difficulties Milestones Questions

  4. Background Part 2 • Why do we want to do that? • We don’t actually know what this particular gene does. • Useful gene denotes a functionality or a trait • By comparing with isolated protein, we can find out where is exactly these genes are and does. • Example: Insulin • Insulin -> isolated from human • Do a base pair match against a genome database of a plant • Find out whether the plant can be candidate to produce a insulin substitute Background Problem Solution Technical Difficulties Milestones Questions

  5. Background Part 3 • How do we do this? • United States National Center For Bioinformatics Information • BLAST (Basic Local Alignment Sequencing Tool) Background Problem Solution Technical Difficulties Milestones Questions

  6. Background Part 4 AACGTTTCCAGTCCAAATAGCTAGGC ===--=== =-===-==-====== AACCGTTC TACAATTACCTAGGC Hits(+1): 18 Misses (-2): 5 Gaps (existence -2, extension -1): 1 Length: 3 Score = 18 * 1 + 5 * (-2) – 2 – 2 = 6 Background Problem Solution Technical Difficulties Milestones Questions

  7. Problem • How do we process the information here? • How do researchers make sense out of it? E.g. 7000 records • Is there a better way to use the information here in a more aggregated context? • Can this information be shared among other users? Background Problem Solution Technical Difficulties Milestones Questions

  8. Solution • To present the data in a way that is relevant to the bio informatics context • Visualizing the data in a very intuitive way Background Problem Solution Technical Difficulties Milestones Questions

  9. Technical Difficulties • Deploying ex server • Understanding what the terms in the data mean • Transforming data into a useful format for analysis • Have to first analyze researchers’ difficulty Background Problem Solution Technical Difficulties Milestones Questions

  10. Milestones • Wiki write up and proposal • Testing current NCBI system • Data cleaning • Building Panopticon solution • Deploying EX Server Background Problem Solution Technical Difficulties Milestones Questions

  11. Questions Background Problem Solution Technical Difficulties Milestones Questions

More Related