COT 6930 HPC and Bioinformatics Introduction to Molecular Biology

1. COT 6930HPC and BioinformaticsIntroduction to Molecular Biology Xingquan Zhu Dept. of Computer Science and Engineering

2. Outline • Cell • DNA • DNA Structure • DNA Sequencing • RNA (DNA-> RNA) • Protein

3. Life begins with Cell • Cells are fundamental working units of every living system. • A cell is the smallest structural unit of an organism that is capable of independent function • Unicellular organism (Any living being consisting of a single cell): mainly bacteria • Multicellular organism (Organisms consisting of more than one cell): Plant and animal • All cells have some common features • Membrane, cytoplasm • Cell is able to survive and multiply independently in appropriate environment • There are estimated about 6x1013 (60 trillions) cells in a human body, of about 210 distinct cell types • Cells may have different sizes: a human red blood cell may be 5 microns in diameter while some neurons are about 1 m long (from spinal cord to leg) • Name a cell visible with naked eyes..

4. Cell • The basic unit of life • Every living thing is made of cells. • Every cell comes from a pre-existing cell • All of life’s functions are cellular • Living organisms (on Earth) require ability to • Separate inside from outside (lipids) • Build 3D machinery to perform biological functions (proteins) • Store information on how to build machinery (DNA)

5. Organisms – Eukaryotes and Prokaryotes • Every organism is composed of one of two radically different types of cells: prokaryoticcells or eukaryotic cells. • Prokaryotic cells are simpler than eukaryotic cells • Prokaryotes are (mostly) single cellular organisms • Eukaryotic cell has a nucleus, separated from the rest of the cell by a membrane • Eukaryotes can be single cellular (Yeast) or multicellular (animals, plants)

6. Organisms – Eukaryotes and Prokaryotes

7. Structure of a Eukaryotic Cell • Nucleus contains chromosomes, which are the carrier of the genetic material • Organelles like centrioles, lysosomes, golgi complexes are enclosed compartments within the cell and are responsible for particular biological processes • Area of the cell outside the nucleus and the organelles is called the cytoplasm

8. Composition of Cells • Cell membrane • Boundary between cell and outside world • Cell membranes consist of two layers of lipid molecules with hydrophobic ends facing in (keeps water out) • Nucleus • Contain genetic material • Separated from the rest of the cell by a nuclear membrane

9. The nucleus 1. nuclear envelope2. nucleolus3. chromosomes chromosomes

10. All Cells have common Cycles • Growth of a single cell and its subsequent division is called the cell cycle M: Mitosis • Prokaryotes, particularly bacteria, are extremely successful at multiplying. • Multicellular organisms typically begin life as a single cell. The single cell has to grow, divide and differentiate into different cell types to produce tissues and in higher eukaryotes, organs

11. All cells come from pre-existing cells

12. Molecular Biology: Studying life at the molecular level • DNA • Protein • RNA • mRNA • rRNA • tRNA • Protein synthesis • Protein transcription • Protein translation

13. Molecules of Life • All Life depends on 3 critical molecules– DNA, RNA, and Protein • All 3 are specified linearly • DNA and RNA are constructed from nucleic acids (nucleotides) • Can be considered to be a string written in a four-letter alphabet (A C G T/U) • Proteins are constructed from amino acids • Strings in a twenty-letter alphabet of amino acids

14. DNA RNA protein Central dogma of molecular biology phenotype

15. DNA, RNA, Protein Self replication and genetic code DNA DNA → DNA (Replication) RNA DNA → RNA (Transcription / Gene Expression) Protein RNA → Protein (Translation)

16. Outline • Cell • DNA • DNA Structure • DNA Sequencing • RNA (DNA-> RNA) • Protein

17. DNA (Deoxyribonucleic Acid ) Structure • Physical structure • Double (stranded) helix • Sugar & phosphate groups form backbone • Complementary bases (A-T, C-G) connected by hydrogen bond • 5’ = end w/ free phosphate group • 3’ = end w/ free oxygen group

18. DNA • Composition • Sequence of nucleotides • Deoxyribonucleotide = deoxyribose sugar + phosphate group + base

19. Nucleotide Bases

20. Nucleotides • The five-carbon sugar (a pentose) in nucleotides has two types • Deoxyribose, which has a hydrogen atom attached to its #2 carbon atom (designated 2') : DNA • Ribose, which has a hydroxyl group atom there: RNA

21. DNA structure

22. Why 5’ and 3’ • Deoxyribonucleotide = deoxyribose sugar + phosphate group + base The deoxyribose sugar in DNA is a pentose, a five-carbon sugar. Four carbons and an oxygen make up the five-membered ring; the other carbon branches off the ring. The carbon constituents of the sugar ring are numbered 1'-4' (pronounced "one-prime carbon"), starting with the carbon to the right of the oxygen going clockwise. The fifth carbon (5') branches from the 4' carbon.

23. DNA - Denaturation, Hybridization

24. DNA • For bioinformatics • DNA can be represented as a sequence of letters (A,C,G,T) • 5’ A T A C G T A 3’ • 3’ T A T G C A T 5’ (matching strand, redundant) • Terms • Base pair (bp) – one pair of DNA bases (1 letter) • Gene – section of DNA that produces a functional product • Chromosome – physical linear sequence of DNA • Genome – entire collection of DNA for an organism • E Coli 1 chromosome 5 x 106 bases (5 Mbps) • Drosophila 8 chromosomes 2 x 108 bases (200 Mbps) • Human 48 chromosomes 3 x 109 bases (3 Bbps)

25. DNA Replication • DNA can be replicated • DNA strands are split • DNA polymerase (enzyme) reads one strand (template) • Builds new (complementary) strand to form duplicate DNA

26. DNA fascinating fact Each cell has 2m of DNA Average person has 75 trillion cells = 75 * 1012 Length of DNA in a person = 150 * 1012 m Each person has enough DNA to go to the sun and back 500 times

27. Organization of DNA in chromosomes Histone proteins 3 bases/ amino acid 27,000 bases/ protein (1 gene) 3,000,000,000 base pairs/ genome 20,000 genes/ genome Human Genome Project homologous

28. Genome • Gene: Contiguous subparts of single strand DNA that are templates for producing proteins. • Chromosomes: compact chains of coiled DNA • Genome: The set of all genes in a given organism. • Noncoding part: The function of DNA material between genes is largely unknown. Source: www.mtsinai.on.ca/pdmg/Genetics/basic.htm

29. More Terminology • The genome is an organism’s complete set of DNA. • A bacteria contains about 600,000 DNA base pairs • Human and mouse genomes have some 3 billion. • Human genome has 23 pairs of chromosomes. • Each chromosome contains many genes. • Gene • Basic physical and functional units of heredity. • Specific sequences of DNA bases that encode instructions on how to make proteins.

30. DNA sequences in the human genome

31. DNA homologies 98.7%

32. Outline • Cell • DNA • DNA Structure • DNA Sequencing • RNA (DNA-> RNA) • Protein

33. DNA Sequencing (Sanger’s Dideoxy Method) • Method for identifying short DNA sequences • Algorithm • Replicate DNA with (color-labeled) dideoxy-nucleotides • Creates fragments of DNA • Apply gel electrophoresis • Separates fragments based on size • Machine scans gel • Records level of color found at each position • Software calls bases • Predicts base at each position • Limitations • Upper bound of 700-800 bases on sequence length • Larger DNA sequences will need to be assembled

34. DNA Sequencing • Dideoxynucleotides • Similar to normal nucleotide base • Missing 3’ hydroxyl group terminates DNA sequence • May be chemically modified to fluoresce under UV light

35. DNA Sequencing • Example for GCGAATGTCCACAACGCTACAGGTG • Replicate DNA in the presence of dideoxy-Cytidine (ddC) • Replication terminates when ddC is used instead of C • Produces the following DNA fragments • GC • GCGAATGTC • GCGAATGTCC • GCGAATGTCCAC • GCGAATGTCCACAAC • GCGAATGTCCACAACGC • GCGAATGTCCACAACGCTAC

36. DNA Sequencing • Gel electrophoresis • Place DNA fragments in gel • Apply electric field • Speed of fragment is determined by size • Smaller = faster • Larger = slower • After given time • Fragments are separated in gel • Fragments are sorted by size (number of bases)

37. Gel electrophoresis

38. DNA Sequencing

39. DNA Sequencing

40. Outline • Cell • DNA • DNA Structure • DNA Sequencing • RNA (DNA-> RNA) • Protein

41. Replication Transcription Translation Central Dogma of Biology: DNA, RNA, and the Flow of Information

42. Ribonucleic acid (RNA) • Composition • Sequence of nucleotides • Ribonucleotide = ribose sugar + phosphate group + base • Major difference between DNA and RNA • RNA: usually single stranded • RNA: ribose sugar, DNA: Deoxyribose sugar • RNA: Uracil (U) instead of Thymine (T) • DNA → RNA (Transcription / Gene Expression) • RNA polymerase (enzyme) • Finds gene initiation marker (codon) on DNA strand • Reads DNA strand containing marker • Builds (complementary) strand of messenger RNA (mRNA) • Stops when gene end marker (codon) found • Resulting RNA sequence = transcript

43. Ribonucleotides • The five-carbon sugar (a pentose) in nucleotides has two types • Deoxyribose, which has a hydrogen atom attached to its #2 carbon atom (designated 2') : DNA • Ribose, which has a hydroxyl group atom there: RNA

44. Transcription Example (1)

45. Transcription Example (2)

46. Transcription Example (3)

47. Transcription Example (4)

48. Transcription Example

49. What is Enzyme? • Proteins that catalyze (i.e. accelerate) chemical reactions • They are not living things • Two types of Enzyme • Join specific molecules together to form new molecules • Break specific molecules apart into separate molecules • Things about Enzyme • Enzymes are specific: Performing only one specific job, about 3000 types enzymes identified so far • Enzymes are catalysts: Can perform that same job over and over again, millions of times, without being consumed in the process. • Enzymes are efficient: • Enzymes are natural: Once they have done their job, enzymes break down swiftly and can be absorbed back into nature

50. Outline • Cell • DNA • DNA Structure • DNA Sequencing • RNA (DNA-> RNA) • Protein