1 / 45

Gene Expression DNA  RNA  Protein Transcription  Translation What is the language of DNA?

Gene Expression DNA  RNA  Protein Transcription  Translation What is the language of DNA?. DNA Double Helix- Deoxyribonucleic acid “ Genetic material of Life” “Twisted” ladder. Nucleotides - Building Blocks. Nucleotide- Base, sugar, phosphate group. Nitrogen Bases. Purine , Adenine,

peter-perkins
Download Presentation

Gene Expression DNA  RNA  Protein Transcription  Translation What is the language of DNA?

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript

  1. Gene ExpressionDNA  RNA  ProteinTranscription  TranslationWhat is the language of DNA?

  2. DNA Double Helix- Deoxyribonucleic acid“Genetic material of Life” “Twisted” ladder

  3. Nucleotides- Building Blocks

  4. Nucleotide- Base, sugar, phosphate group

  5. Nitrogen Bases • Purine, • Adenine, • Guanine, • Pyrimidine. Thymine, • Cytosine • “Y”- pyrimidine

  6. Complimentary Base pairs • Adenine - -Thymine • (A T & T) - two • Cytosine - - - Guanine • Combine by double / triple bonds. • (-) = Hydrogen bonds

  7. DNA Double Helix

  8. DNA Replication DNA replication (chromosomes replicated during S phase)is SEMI-CONSERVATIVE. http://www.youtube.com/watch?v=AGUuX4PGlCc

  9. What is semi-conservative? Match Original two strands of DNA (at left)- Which figure below represents semi- conservative copying? B A C D

  10. Replicated DNA contains ½ one Old and ½ one New – why? Fig. 11-9 Iguana, 9-9 Manatee • Reduce mistakes and is faster. Replication  DNA Replicationhttp://www.johnkyrk.com/DNAreplication.html Simple Best DNA- http://www.lewport.wnyric.org/jwanamaker/animations.htm

  11. DNA Replication • DNA is “unzipped” by DNA Helicase (Helix is shape of DNA = spiral)

  12. DNA Replication New bases added by DNA Polymerase. 5’ to 3’, direction. (like one end to other).

  13. DNA Replication Give complimentary side of this sequence • DNA below • TAC/ACC/TAG/CTT/TTGACGGGGAACCCCATT • ATG/TGG/ATC/GAAAACTGCCCCTTGGGGTAA • DNA is proofread and errors are only 1 in every Billion nucleotides!

  14. Objectives • CompareThe structure of RNA with that of DNA. • SummarizeTranscription- DNARNA

  15. Gene Expression/ Central Dogma for Molecular Biology • DNA(Transcription) RNA  (Translation) Proteins

  16. Decoding the Information in DNA • Traits-eye color, hair color determined by proteins, built according to instructions coded in DNA. • Proteins however, not built directly from DNA but from Ribonucleic acid. • Ribonucleic acid (RNA)nucleic acid similar to DNA.

  17. DNARNA- Transcription • DNA is like a book, Chapters are Chromosomes, Sections are Genes • DNA stays protected in nucleus • ** (Do not want to damage)** • RNA is copied from shorter sequence of DNA, leaves nucleus • RNA is Working copy of DNA- leaves nucleus.

  18. Transcription-(Nucleus)

  19. Removal of intronsAfter Transcription- mRNA leaving is called exons = GENE

  20. 3 Types of RNA

  21. Ribonucleic Acid

  22. Comparing DNA/RNA- 3 differences DNA RNA Single strand Ribose Sugar Uracil NO Thymine A-U C-G • Two strands • Deoxyribose Sugar • Thymine A- - T C ---G

  23. Transcription- (Nucleus) • RECALL- DNA/DNA • TAC/ACC/TAG/CTT/TTGACGGGGAACCCCATT • ATG/TGG/ATC/GAA/AACTGCCCCTTGGGGTAA • Given DNA sequence below • What is the complimentary mRNA? Recall NO Thymine! • TAC/ACC/TAG/CTT/TTG/ACG/GGG/AAC/CCC/ATT • AUG/UGG/AUC/GAA/AAC/UGCCCCUUGGGGUAA

  24. Objectives • OutlineThe major steps of translation. • RelateCodons to the sequence of amino acids that results after translation. • DiscussThe evolutionary significance of the genetic code.

  25. Chapter 10 Section 1 From Genes to Proteins Translation: Assembling Proteins

  26. Translation-(Cytoplasm) RNA Proteins • RNA Code is read • CODON – “Code on” mRNA- messenger RNA • CODON= 3 Bases ON- results in Amino Acid • Chain of Amino Acids makes protein (polypeptide)

  27. TranslationRNA Protein • UGUUAUAUCGAAAACUGCCCCUUGGGGUAA • Read every 3 bases= CODON • UGU/UAU/AUC/GAA/AAC/UGC/CCC/UUG/GGG/UAA

  28. Codon- sheet • Why read every 3 bases? • Codon combinations must cover 20 different AA- Amino Acids • 41 = 4 • 42 = 16 • 43 = 64 CHECK! • Results in 64 combinations • Start sequence AUG. • End sequence UAA, UAG, UGA.

  29. Codes in mRNA

  30. TranslationRNA Protein • UGUUAUAUCGAAAACUGCCCCUUGGGGUAA • Read every 3 bases= CODON • UGU/UAU/AUC/GAA/AAC/UGC/CCC/UUG/GGG/UAA

  31. Amino Acids • Amino acids can be • Polar/Non Polar • Hydrophobic/Hydrophilic • Acidic/Basic • Depending on sequence this will make a shape = GENE

  32. Chapter 10 Section 1 From Genes to Proteins Translation: Forming the First Peptide Bond

  33. tRNA • tRNA- Transfer RNA, “transfers” the Amino Acid to the ribosome to make protein • tRNA is complimentary to mRNA, “lock & key” fit. Every codon has only one Anticodon. • AUG/CAA- Codon • UAC/GUU- Anticodon- specific AA • Met-Glu- Amino acids

  34. Chapter 10 Section 1 From Genes to Proteins Translation: Assembling Proteins

  35. Video showing transcription/translation • https://www.youtube.com/watch?v=erOP76_qLWA

  36. Mutations

  37. Major Types of Mutations

  38. Mutation-Change in sequence of the DNA- deoxyribonucleic acid • A. Chromosomal- whole, parts added or deleted, sections translocated to other chromosomes. • B. Gene- • 1. Point • 2. Frameshift. Somatic-affects individual- EX. skin cancer. Genetic- affects sperm or egg affects offspring.

  39. Gene mutations 1. Point mutation- affects one nucleotide fig. 11-7 p. 230 Iguana • p. 219 Manatee • Ex. • TAC GTT CCA, change TAC GTA CCA, • If this makes different codon (language of genetics), = new amino acid

  40. Point mutation analogy • The dog ran out the box • Point mutation Change D and C. • The Cog ran out the box.

  41. Frame shift mutation B. Frame shift mutation- removal of a base(s) or insertion of a segment, results in different “reading” of gene. CODON= 3 bases. • TAC GTT CCA- original sequence. T(AC G)TT CCA  remove first (T) ACG TTC CA…. TA)C GTT CCAinsert T TTA CGT TCC A

  42. Frame shift mutation analogy • The dog ran out the box • TTh edo gra nou tth ebo x. ADDITION of a T • Hegogranouthheb ox DELETION of a T

  43. Genetic Code- Evolutionary significance • The code AUG/CCC/, whether in human or oak tree, or mosquito, etc.. makes same amino acids….Met--Pro • This shows relatedness of all living organisms.

  44. How can a glow in the dark gene from Jellyfish work in a pig? • DNA is a code like words if it fits and makes sense, then it can be used. • Thedogran down the street. • The cat ate a bird. • The dog ate a bird. Still makes “sense”.

More Related