1 / 41

Module 4: Understanding KO designs

Module 4: Understanding KO designs. Mark Thomas Wellcome Trust Sanger Institute. Aims. Understand design criteria and selection of critical exons View designs using genome browsers Assess the effect of a particular design on gene transcripts

phuoc
Download Presentation

Module 4: Understanding KO designs

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript

  1. Module 4: Understanding KO designs Mark Thomas Wellcome Trust Sanger Institute

  2. Aims • Understand design criteria and selection of critical exons • View designs using genome browsers • Assess the effect of a particular design on gene transcripts • Search for design/allele information using BioMart

  3. Design criteria KO-first tagged allele Wild-typeconditional allele Null-allele One design, three alleles

  4. Design criteria Tagged allele – requires insertion of reporter cassette, ideally located 5’ Wild-type conditional allele – requires native splicing to be maintained Null-allele – requires a critical exon that induces a frameshift Other considerations; - alternative splicing (ie. nAGxxnAG, exon skipping) - repeat elements - conserved elements - targeting efficiency (ie. Insertion size) - domain structure - translation reinitiation

  5. Design criteria

  6. Viewing designs Export for csv files Links to genome browsers

  7. Viewing designs Design 213835 1.5x

  8. Viewing designs Conservation Repeats Design 213835 Gene Models mRNA transcripts

  9. Viewing designs Conservation Repeats Design 213835 U-oligos D-oligos Gene Models mRNA transcripts

  10. Viewing designs Conservation Repeats Design 213835 Gene Models mRNA transcripts

  11. Assessing CE selection Transcript and Protein identifier links

  12. Assessing CE selection Exons link

  13. Assessing CE selection U-oligos (intron 2) Intron/Exon phases Exon sizes (bp) D-oligos

  14. Assessing CE selection Coding Exons Protein Summary

  15. KO: transcripts in VEGA

  16. KO: transcripts in VEGA Fahd2a Critical Exon KO:Fahd2a

  17. KO: transcripts in VEGA Fahd2a Exon 3 - frameshifted KO:Fahd2a

  18. KO: transcripts in VEGA Fahd2a Exon 3 Exon 1 KO:Fahd2a Exon 3 – Alt. frame

  19. Custom design tool http://www.sanger.ac.uk/htgt/design/designedit/show_create

  20. Artificial intron designs AG|G or AG|A Knockout-first wt conditional Null allele

  21. Artificial intron designs Exon 1 Targeted allele Exon 1b 1a

  22. Using BioMart to search Simple searches using knockoutmouse.org More complex searches using biomart.org

  23. Simple searches Simple searches using knockoutmouse.org Possible to browse by products, phenotype, location and name

  24. Simple searches Simple searches using knockoutmouse.org

  25. Simple searches Results page displays data from multiple resources

  26. Simple searches Results page displays data from multiple resources

  27. BioMart searches BioMart allows users to query databases using a standard interface.

  28. BioMart searches GWAS Central - searching for interesting gene targets Step 1. Use filters to restrict search parameters gwascentral.org

  29. BioMart searches Select attributes for results output

  30. BioMart searches Apply additional filters to further restrict results

  31. BioMart searches Results from GWAScentral knockoutmouse.org

  32. BioMart searches Vectors, ES cells and mice available knockoutmouse.org

  33. BioMart searches • BioMart builds queries using a series of dropdown menus, identifying; • Database selection • Filters – defines search terms • Attributes - selects results to be returned

  34. BioMart searches Search results are returned in a table, containing links to data sources

  35. BioMart searches Different databases/datasets can be linked in BioMart, allowing results to be combined. IKMC dataset Europhenome dataset

  36. Resources Ensembl – www.ensembl.org VEGA – vega.sanger.ac.uk UCSC – genome.ucsc.edu MGI – www.informatics.jax.org IKMC portal – www.knockoutmouse.org Europhenome – www.europhenome.org GWAScentral – www.gwascentral.org BioMart – www.biomart.org

  37. Genbank Genbank files can be downloaded for every vector in IKMC

  38. Genbank

  39. Design criteria Max 3.5kb

  40. Translation Re-initiation - critical exons should be as 5’ as possible Unless, the resulting KO translation is less than 35aa, as under these conditions translation may be reinitiated, producing an N-terminally truncated protein. Bcam

  41. Translation Re-initiation ATGGAACCCCCTGACGCCCGCGCAGGGCTGCTGTGGCTCACCT TCCTGCTGTCGGGCTACTCAG GTTGATGGTACTGGGGCTCGACACCGTCTGGCTTCTGTGGAACCACAGGGCTCAGAGTTC CTGGGCACAGTCCACTCTCTGGGCCGCGTACCCCCATACGAGGTAGACTCTCGTGGGCGC CTGGTGATAGCAAAGGTCCAGGTGGGCGATGGACGGGACTACGTGTGCGTAGTGAAGGCT GGGGCAGCGGGTACCTCAGAGGCCACCTCAAGTGTCCGTGTGTTTG Translation 1 MEPPDARAGL LWLTFLLSGY SG*WYWGSTP SGFCGTTGLR VPGHSPLSGP 51 RTPIRGRLSW APGDSKGPGG RWTGLRVRSE GWGSGYLRGH LKCPCV

More Related