10 likes | 171 Views
0.5 kb. rsmY. putative transcriptional regulator gene of the LysR family PFL 5683. putative acyl-CoA dehydrogenase gene PFL 5684. UAS. NcoI. TGAGCAGTTTTAACCA CCATGG GCGTTTGTAAGTCATCTCTTACATAACGTGCTGCT GCAAGG GATCGTCCATATCGGT AGATCT CGGCTGAAGCTAATCTACTTCAC A AGATGA.
E N D
0.5 kb rsmY putative transcriptional regulator gene of the LysR family PFL 5683 putative acyl-CoA dehydrogenase gene PFL 5684 UAS NcoI TGAGCAGTTTTAACCACCATGGGCGTTTGTAAGTCATCTCTTACATAACGTGCTGCT GCAAGG GATCGTCCATATCGGTAGATCTCGGCTGAAGCTAATCTACTTCACA AGATGA BglII -35 -10 +1 FIG. S1. Organization of the 2.6-kb rsmY gene region in strain CHA0. The sequence of the rsmY promoter region is shown in the lower part. UAS, upstream activating sequence; -35 and -10, putative promoter elements; +1, transcription start site; artificially introduced NcoI and BglII sites in pME7654 are indicated in bold face. These sites have no apparent effect on rsmY expression.