1 / 19

UGA

UGA. MARKER-ASSISTED SELECTION FOR NEMATODE RESISTANCE. Ye (Juliet) Chu Peggy Ozias-Akins Department of Horticulture University of Georgia Tifton Campus Corley Holbrook Patricia Timper USDA-ARS Coastal Plain Experiment Station. UGA. NEMATODE-RESISTANT GERMPLASM.

rangsey
Download Presentation

UGA

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript

  1. UGA MARKER-ASSISTED SELECTION FOR NEMATODE RESISTANCE Ye (Juliet) Chu Peggy Ozias-Akins Department of Horticulture University of Georgia Tifton Campus Corley Holbrook Patricia Timper USDA-ARS Coastal Plain Experiment Station

  2. UGA NEMATODE-RESISTANT GERMPLASM A. batizocoi x (A. cardenasii x A. diogoi) colchicine Florunner x TxAG-6 xxxxx Florunner x COAN xx NemaTAM R2430E; R2545E Simpson et al. 2003. Crop Science 43:1561 Church et al. 2000. Nematology 2:575

  3. UGA x x x x x x x x x x x x x x x NEMATODE-RESISTANT GERMPLASM A. hypogaea x A. cardenasii colchicine 6x F1 4x hybrid introgression lines Smartt and Gregory. 1967. Oleagineux 22:455 Garcia et al. 1996. Genome 39:836

  4. UGA MARKER-ASSISTED SELECTION Phenotype Inoculate Score RFLP DNA extraction Quantitation RE digestion Test gel Electrophoresis Blotting Hybridization Probe labeling Detection PCR-based DNA extraction PCR RAPD Electrophoresis AFLP SCAR or STS SSR

  5. UGA GOAL – PCR-BASED MARKERS Garcia et al. 1996. Genome 39:836 Z3/265 – RAPD converted to a SCAR Linked to 2 nematode-resistance genes on LG1 of peanut Resistance introgressed from A. cardenasii ~10 cM from Mag (restricted galling) ~14 cM from Mae (restricted egg formation) NemaTAM Tifrunner COAN COAN water C99R GG

  6. UGA Z3/265 DNA SEQUENCE

  7. UGA A SECOND PCR-BASED MARKER FROM THE LITERATURE Burow et al. 1996. Molecular Breeding 2:369 RKN440 – 600 bp RAPD marker amplified by UBC440 Linked to single nematode-resistance gene Resistance introgressed from A. cardenasii or A. diogoi ~6 cM from resistance gene

  8. UGA RKN440 CONVERTED TO A SCAR Sequenced by Burow et al. 1996 GenBank IDs ACU65587 & ACU65588 Designed primers to forward and reverse sequences (these primers incorporated the RAPD primer sequence: 5’ CTGTCGAACCATGGAAGAAGATCC 3’ 5’ CTGTCGAACCGGTTAAGTCGGTG 3’

  9. UGA 1: RKN440 SCAR 2: Actin depolymerizing factor 3: Z3/265 NemaTAM Tifrunner COAN water 500 bp 200 bp

  10. UGA PHENOTYPE vs MARKER False positives with Z3/265 False negatives with RKN440

  11. UGA DEVELOPMENT OF SECOND MARKER FOR RKN440 Cloned RKN440 SCAR from COAN and sequenced

  12. UGA DEVELOPMENT OF SECOND MARKER FOR RKN440 197/909 198/912 197/910 198/911

  13. UGA AMPLICON SIZE DIFFERENCE BETWEEN RESISTANT AND SUSCEPTIBLE USING PRIMER SET 197/909 COAN COAN water mix GG GG 5% acrylamide

  14. UGA Sequence of Fragment Amplified and Cloned from Georgia Green

  15. UGA MARKER SEGREGATION NemaTAM NC-WS14 14 segregating individuals water Z3/265

  16. UGA R S S R R R R S S S S S S S R R R R R R R S S S S S S S S S S S R S R R R R R R S S S S S S R S S S N ADVANCED POPULATION SCREENING – CROSSES WITH COAN AND NemaTAM Advantage: similar to co-dominant marker Amplicon in susceptible serves as amplification control

  17. UGA F2 Population from Cross of NemaTAM and GP-NC WS14 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 95 96 w

  18. UGA FURTHER MARKER DEVELOPMENT USING ADVANCED BACKCROSS LINES AFLP – from 64 primer combinations, 14 potential markers identified out of >3000 bands

  19. UGA CONCLUSIONS Published marker (Z3/265) from Garcia et al. 1996 often gave false- positive signal RAPD marker (RKN440) from Burow et al. 1996 was converted to a SCAR, but often gave false-negative results New RKN440 SCAR marker produces internal control amplicon from susceptibles that is slightly smaller than the amplicon from nematode-resistant genotypes Further marker development through AFLP analysis is in progress

More Related