1 / 21

Everything you wanted to know about DNA but were afraid to ask.

Everything you wanted to know about DNA but were afraid to ask. DNA. A molecule that is present in all living cells and contains the information that determines the traits that a living thing inherits and needs to survive. DNA. Gives you your characterisitcs

saber
Download Presentation

Everything you wanted to know about DNA but were afraid to ask.

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript

  1. Everything you wanted to know about DNA but were afraid to ask.

  2. DNA • A molecule that is present in all living cells and contains the information that determines the traits that a living thing inherits and needs to survive.

  3. DNA • Gives you your characterisitcs • Traits like eye color, height, & hair texture.

  4. DNA’s Two jobs • Instruction manual that builds and maintains cells • Able to copy itself each time a cell divides

  5. DNA DOUBLE HELIX-Twisted ladder or spiral staircase Sides of ladder are made of molecules of sugar called deoxyribose alternating with molecules of phosphate The rungs of the ladder are made of nitrogen bases: Adenine A Thymine T Guanine G Cytosine C

  6. A little History Rosalind Franklin • She made the first image of an actual DNA molecule using x-ray diffraction • Through this breakthrough we learned that DNA has a spiral shape

  7. Watson & Crick • 1953’s they built the first model of DNA • Won the Nobel Prize

  8. Erwin Chargaff • 1950’s Chargaff found equal amounts between certain base pairs • Adenine=Thymine • Cytosine=Guanine • Called Chargaff’s Rules

  9. Making copies of DNA • This occurs in interphase • Adenine always pairs w/ Thymine A~~~~~~~~ T • Cytosine always pairs w/ Guanine C~~~~~~~~G

  10. How copies are made • DNA unwinds and separates (like a zipper) • Bases on the open strand are used as a pattern for the new strand • Nitrogen bases that are floating in the nucleus pair up with the bases on each half of the unzipped DNA • Half of DNA is old & half is new

  11. How DNA works • About 2 meters of DNA in every cell of your body • It is wound, coiled and bundled to fit inside every cell • Order of the bases on one side is a CODE that carries information • Gene- is a piece of that code that gives the cell information on the trait it controls

  12. Reading the Code • ATTGGCCTTGATCCCCCATAGCGATGTGTACACTC • The code is read like a book from one end to another • They are split up by 3’s • AGC is a code for a protein called “serine”

  13. When things go wrong!

  14. Mutations: the causes DNA damage from environmental agents such as ultraviolet light (sunshine), nuclear radiation or certain chemicals Mistakes that occur when a cell copies its DNA in preparation for cell division. Changes in the number, type, or order of bases on DNA

  15. Types of Mutations Deletion- When a base is left out Insertion- When a base is added Substitution - Occurs when the wrong base is used

  16. What can happen? • Improved trait • No change • Harmful trait such as sickle cell disease

  17. Clones A new organism with an exact copy of DNA from another organism This is CopyCat: the first cat cloneResearchers in Texas have cloned a domestic cat, producing a two-month-old kitten called CopyCat.

More Related