HANNIE KREMER KNO & ANTROPOGENETICA

1. HANNIE KREMER KNO & ANTROPOGENETICA

2. ANTROPOGENETICA – HUMAN GENETICS

3. Things we do • Map diseases to chromosomes (position) - monogenic and complex disorders • Interpret DNA variation – monogenic and complex disorders • Understand the function of genes - pathogenesis • Therapy 98% Identical 99,8% identical

4. Things we do • Map diseases to chromosomes (position) - monogenic disorders • Interpret DNA variation – monogenic and complex disorders • Understand the function of genes - pathogenesis • Therapy

5. MAP DISEASES TO CHROMOSOMES MONOGENIC DISORDERS

6. A B Linkage: If a gene and a marker are on the same chromosome they will segregate together UNLESS They are separated by recombination n * B A n *

7. A B A B * n * n B A B A * n n *

8. Robinow syndrome Short stature Wide-spaced eyes Short nose Small penis

9. ROR2 Linkage interval Robinowsyndroom cM Chromosoom 9q21-q22.3 D9S1842 2.8 D9S1781 2.1 D9S197 0.6 D9S1816 max = 6.47  = 0 D9S1842 0.1 D9S280 1.4 D9S1851 0 D9S287 1.6 D9S176 Human Genetics Nijmegen

10. Robinowsyndrome Ror2 null mouse Human Genetics Nijmegen From DeChiara et al. Nature Genetics March 2000

11. MAP DISEASES TO CHROMOSOMES COMPLEX DISORDERS

12. Genotyping Single Nucleotide Polymorphisms (SNPs) > 1 SNP per >3 kb ~ 1,000,000 SNPs PersonA: PersonB: …cctcctagggttgcaaagcctccttggctatg… …cctcctagggttgcatagcctccttggctatg… Allel 1 …cctcctagggttgcatagcctccttggctatg… …cctcctagggttgcatagcctccttggctatg… Allel 2

13. 500,000 SNPs Whole genome association studies Diabetes type 1 Obesity ADHD 2000 cases 4000 controls SNPs indicate genes involved arrays Case control design Gene 1 Gene 2 Gene 3 Gene 4 …… Gene 30.000

14. 500,000 SNPs Whole genome associationstudy Obesitas 9000 cases 30000 controls BMI > 30 FTO gene arrays Case control design Frayling et al. A common variant in the FTO gene is associated with body mass index and predisposes to childhood and adult obesity. Science 316: 889-894, 2007.

15. 500.000 SNPs Whole genome associationstudy Obesitas 9000 cases 30000 controls BMI > 30 FTO gene arrays FTO gene 35% +0 kg 50% +1.5 kg 15% +3.0 kg

16. INTERPRET GENETIC VARIATION • Sequencevariation at a specificnucleotide • Copynumbervariations (CNV)

17. SAM DNA binding Iso TA p63 gene mutations in EEC syndrome TA-p63 A315E L162P R313G Y163C D312H D312N Ins A Y192C (3) C269Y P309S C308S C308Y S272N V202M C306R L248C R279C (3) R279H (12) R279Q R304W (8) R304Q (14) R304P R204W (10) R204Q (7) R204L R227Q (8) R280C (6) R280H (2) R280S 29 Mutations in 90 families 28 missense 1 frameshift

18. Structure model of p63 DNA binding domain

19. 276 copy number abnormalities in 100 patients with Mental Retardation How do we differentiatenormalvariationfromcausalchanges?

20. Patient 1 Genomic profile obtained 250K SNP array Log 2 Patient/Control

21. Chromosome 1 Paient1 Chromosome 15 Chromosome 1 Chromosome 15 Mother Father Chromosome 1 Chromosome 15 de novo inherited variation

22. Alex Hoischen Christian Gillisen NextGenerationsequencing

23. 1953 The complete genome of an individual by massively parallel DNA sequencing. Wheeler et al. Nature, April 2008 Here we report the DNA sequence of a diploid genome of a single individual,James D.Watson,sequenced to 7.4-fold redundancy in two months using massively parallel sequencing

24. Nature genetics Question of the year 2007 The sequencing of the equivalent of anentirehuman genome for $1,000 has been announced as a goal for the geneticscommunity What would you do if this sequencing capacity were available immediately?

25. Can we look at the all EXons of the genOME? Exome sequencing! 1.) Sequence Capture 2.) Sequencing 3.) Mapping mapped reads formed contigs targeted exon(s) 4.) Mutation detection

26. ABI SOLID 600 million map-able 50bp reads  30Gb Roche 454 1 million map-able 500bp reads  500Mb

27. * Per individual genome ~3,000,000 SNP variants* ~1,000,000 CNVs* To understand human health and disease we have to understand all types of genomic variation: ~4,000,000 variants ~10,000 non-synonymous coding variants*

28. Focus on de novo disease • 4 DNAs from patients with Schinzel-Giedion syndrome • patient samples n=14 • 4 human exomes: 2.5Gb output per sample

30. Alex Hoischen Bregje van Bon Christian Gillisen De novo mutations of SETBP1 cause Schinzel-Giedion syndrome in 13 patients Alexander Hoischen*, Bregje WM van Bon*, Christian Gilissen*, Peer Arts, Bart van Lier, Marloes Steehouwer, Petra de Vries, Rick de Reuver, Geert Mortier, Koen Devriendt, Marta Z Amorim, Nicole Revencu, Alexa Kidd, MafaldaBarbosa, Anne Turner, Janine Smith, Christina Oley, Alex Henderson, Ian M Hayes, Elizabeth M Thompson, Han G Brunner, Bert BA de Vries, Joris A Veltman Nature Genetics

31. Things we do • Map diseases to chromosomes (position) - monogenic disorders • Interpret DNA variation – monogenic and complex disorders • Understand the function of genes - pathogenesis • Therapy

32. RPGR Photoreceptor cilium protein complex Retinitis Pigmentosa

33. inversin NPHP2 RP2 Arl3 nephrocystin-1 β-tubulin NPHP1 RPGRIP1 CC2D2A PDE-δ IQCB1 NPHP5 nephrocystin-4 RPGR NPHP4 RPGRIP1L Photoreceptorciliumprotein complex * lebercilin nephrocystin-3 NPHP3 Dynein CEP290

34. inversin NPHP2 RP2 Arl3 nephrocystin-1 β-tubulin NPHP1 CC2D2A RPGRIP1 PDE-δ IQCB1 NPHP5 nephrocystin-4 RPGR NPHP4 RPGRIP1L Photoreceptorciliumprotein complex Senior Loken LCA Nephron - ophthisis * Joubert lebercilin nephrocystin-3 NPHP3 Joubert RP Dynein CEP290 Joubert / Meckel LCA LCA / Joubert / Meckel

35. GENETICA VAN GEHOORVERLIES ROL VAN BIOINFORMATICA

36. 21 6 16 Known Genes AANGEBOREN GEHOORVERLIES ~ 1 in 900 children has congenital hearing impairment >20 dB in one or more frequencies 50% environmental 50 % inherited • Ototoxic drugs • Acustic trauma • Infections 70% Nonsyndromic 30% Syndromic • Usher • Alport • Pendred • Norrie • Waardenburg • Branchio-Oto-Renal • Jervell and Lange-Nielsen ~%22 AD ~%22 AD ~%77 AR ~%77 AR ~%1 X-linked <%1 Mitochondrial 6

37. WAAROM IS HET OPHELDEREN VAN OORZAKEN VAN ERFELIJKE ZIEKTEN BELANGRIJK? • Vraag van patiënt naar de oorzaak beantwoorden: • is het erfelijk - erfelijkheidsadvies • Vroege diagnostiek van familieleden – goede • begeleiding • Inzicht in genen/eiwitten die essentieel zijn voor • ontwikkeling en functie van het binnenoor • Handvaten voor therapie

38. FAMILIE TR57

39. DFNB63 LOCUS 15.5 15.4 DFNA32 TR57 FT2 15.3 FT1A-G PKDF702 15.2 15.1 USH1C 14.3 D11S987 14.2 14.1 D11S1337 26 bekende of voorspelde genen 13 DFNB51 12 D11S4113 11.2 11.12 DFNB63 11.11 D11S4136 11 DFNB63 12.1 ~5.29 Mb 12.2 DFNB63 1.03 Mb 12.3 D11S4139 13.1 FGF3 13.2 13.3 DFNB63 13.4 D11S1314 DFNB63 13.5 MYO7A 14.1 D11S916 14.2 14.3 D11S2371 21 22.1 22.2 D11S1291 22.3 23.1 DFNB24 D11S4179 23.2 23.3 TECTA 24.1 24.2 24.3 25 DFNB20

40. LRTOMT KARAKTERISATIE Genome browser build 36.1 LRTOMT1 LRTOMT2

41. EFFECT VAN MUTATIES G163VfsX4 (c.358+4G>A) 3’ UTR A215A 3’ UTR A29SfsX54 (c.358+4G>A) W105R E110K R81Q Catechol-O-methyltransferase domein

42. MOLECULAR MODELING

43. EFFECT VAN MISSENSE MUTATIES

44. HET BINNENOOR

45. SAMENVATTING • Bioinformatica is essentieel voor verschillende • stappen in studies naar ziektegenen • De structuur en functie van het humane genoom • en genen zijn nog lang niet in kaart gebracht • De oorzaak van DFNB63 is gelegen in defecten in • het LRTOMT gen. Het precieze effect van • mutaties in dit gen op de functie van het • binnenoor is nog niet duidelijk.