1 / 39

Evolutionary genomics of mycobacterial pathogens - 2 (On the origin of tuberculosis)

Evolutionary genomics of mycobacterial pathogens - 2 (On the origin of tuberculosis). Stewart Cole. M. bovis. M. tuberculosis. Proposed origin. M. tuberculosis derived from M. bovis. Or was it?.

salena
Download Presentation

Evolutionary genomics of mycobacterial pathogens - 2 (On the origin of tuberculosis)

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript

  1. Evolutionary genomics of mycobacterial pathogens - 2(On the origin oftuberculosis) Stewart Cole

  2. M. bovis M. tuberculosis Proposed origin M. tuberculosis derived from M. bovis Or was it?

  3. Proc. Natl. Acad. Sci. USAVol. 94, pp. 9869-74, September 1997GeneticsRestricted structural gene polymorphism in the Mycobacterium tuberculosis complex indicates evolutionarily recent global disseminationS. Sreevatsan, X. Pan, K.E. Stockbauer, N.D. Connell, B.N. Kreiswirth, T.S. Whittam AND J.M. MusserSection of Molecular Pathobiology, Department of Pathology, Baylor College of Medicine, One Baylor Plaza, Houston, TX 77030, USA.Communicated by B.R. Bloom, Albert Einstein College of Medicine, Bronx, NY, July 4, 1997 (received for review May 6, 1997) Recent evolution of TB bacilli ABSTRACT One-third of humans are infected with Mycobacterium tuberculosis, the causative agent of tuberculosis. Sequence analysis of two megabases in 26 structural genes or loci in strains recovered globally discovered a striking reduction of silent nucleotide substitutions compared with other human bacterial pathogens. The lack of neutral mutations in structural genes indicates that M. tuberculosis is evolutionarily young and has recently spread globally. Species diversity is largely caused by rapidly evolving insertion sequences, means that mobile element movement is a fundamental process generating genomic variation in this pathogen. Three genetic groups of M. tuberculosis were identified based on two polymorphisms that occur at high frequency in the genes encoding catalase-peroxidase and the A subunit of gyrase. Group 1 organisms are evolutionarily old and allied with M. bovis, the cause of bovine tuberculosis. A subset of several distinct insertion sequence IS6110 subtypes of this genetic group have IS6110 integrated at the identical chromosomal insertion site, located between dnaA and dnaN in the region containing the origin of replication. Remarkably, study of approximately 6,000 isolates from patients in Houston and the New York City area discovered that 47 of 48 relatively large case clusters were caused by genotypic group 1 and 2 but not group 3 organisms. The observation that the newly emergent group 3 organisms are associated with sporadic rather than clustered cases suggests that the pathogen is evolving toward a state of reduced transmissability or virulence.

  4. Genomics of tubercle bacilli M. tuberculosis complex M. microti M. tuberculosis M. africanum M. bovis M. bovis BCG M. canettii H37Rv CDC1551 K- strain Shotgun Shotgun Shotgun finished AF2122/97 BCG-Pasteur 4.32 Mb 4.31Mb 4.41 Mb Finished In progress

  5. Genome of M. tuberculosis 4,000 genes 40% orphans Maps of other spp. nearly identical Cole et al. (1998) Nature 393: 537-544

  6. Sources of genetic diversity PZA-R • Point mutations or SNP • InDels • Insertions: IS, gene dup, HT, replication errors • Deletions: RecA, IS-mediated, replication errors • Translocations IS6110, BCG Common, RD None to date

  7. Evolutionary Genomics of TB Bacilli

  8. Comparative genomic statistics InDels drive plasticity TbD1: Major region of difference between Mt & Mb Garnier et al. (2003) PNAS 100:7877

  9. TbD1 truncates MmpL6 ∆ M. tuberculosis Might affect lipid/glycolipid export

  10. cobL Rv2073c Rv2074 Rv2075c M. tuberculosis AAATTACTGTGGCCCTGCGCAA.... ..TTGGTGGCACGCCGGGCCGG AAATTACTGTGGCCCACGCCGGGCCGG M. africanum M. microti M. bovis BCG RD9 - an ancient deletion Cannot be due to insertion

  11. RvD2 - a recent deletion M. bovis Rv1758 RvD2-ORF2 RvD2-ORF3 plcD RvD2-ORF1 M. tuberculosis H37Ra IR Rv1758 ’ RvD2-ORF2 IR RvD2-ORF3 Rv1758 ’ IS6110 IS6110 IS6110 plcD ’ plcD’ RvD2-ORF1 IS6110 IR IR Rv1758 ’ D AGC GAG Rv1758 ’ Less informative M. tuberculosis H37Rv IR IS6110 IS6110 plcD ’ IR GAG AGC

  12. RD9 is here! RD regions in M. tb complex

  13. RD 9 RD 7 RD 8 RD 10 RD 9 RD 9 RD 7 RD 8 RD10 RD 4 RD 5 RD12 RD13 RD3 (F Rv1) RD 5’ RD3 (F Rv1) RD distribution in M. tbc M. bov. M. mic. M. can. M. tub. M. afri. BCG TbD1 RD 12’ RD 9 RD 7 RD 8 RD10 RD 4 RD 5 RD12 RD13 RD 1 RD 2 RD11 (F Rv2) RD3 (F Rv1) RD11 (F Rv2)

  14. Evolutionary scenario RDcan M. canettii Numerous sequence polymorphisms “ancestral” TbD 1 RD 9 Common ancestor of the M. tuberculosis complex M. tuberculosis “modern” katG 463 CTGCGG gyrA95AGCACC RD 7 RD 8 RD 10 M. africanum mmpL6 551AACAAG RDmic M. microti RDseal seal-isol. oxyR 285 GA RD 12 oryx-isol. RD 13 Brosch et al.2002 Proc Natl Acad Sci U S A. 99:3684-9. goat-isol. pncA 57CACGAC RD 4 M. bovis “classical” RD 1 BCG Tokyo RD 2 RD 14 BCG Pasteur

  15. Rapid ID of TB bacilli RDcan M. canettii “ancestral” TbD 1 RD 9 M. tub. katG 463 CTGCGG “modern” RD9+ gyrA 95AGCACC RD 7 RD 8 RD 10 M. africanum mmpL6 551AACAAG RDmic M. microti RDseal seal oxyR 285 GA RD 12 oryx RD 13 goat pncA57CACGAC RD 4 M. bovis “classical” RD 1 BCG Tokyo RD 2 RD 14 BCG Pasteur

  16. RDcan M. canettii “ancestral” TbD 1 eg. Beijing cluster RD 9 “modern” katG 463 CTGCGG eg. Haarlem cluster M. tub. RD9+ gyrA 95AGCACC eg. H37Rv RD 7 RD 8 TbD1- RD 10 M. africanum mmpL6 551AACAAG RDmic M. microti RDseal seal oxyR n285 GA RD 12 oryx RD 13 pncAc57CACGAC goat RD 4 M. bovis “classical” RD 1 BCG Tokyo RD 2 RD 14 BCG Pasteur Rapid ID of TB bacilli

  17. RDcan M. canettii “ancestral” TbD 1 RD 9 M. tub. katG 463 CTGCGG “modern” RD9- gyrA 95AGCACC RD 7 RD 8 RD 10 M. africanum mmpL6 551AACAAG RDmic M. microti RDseal seal-isolates oxyR n285 GA RD 12 oryx-isolates RD 13 goat-isolates pncAc57CACGAC RD 4 M. bovis “classical” RD 1 BCG Tokyo RD 2 BCG Pasteur RD 14 Rapid ID of TB bacilli

  18. RDcan M. canettii “ancestral” TbD 1 RD 9 M. tub. katG 463 CTGCGG “modern” RD9- gyrA 95AGCACC RD 7 mmpL6 551 AAG RD 8 RD 10 M. africanum mmpL6 551AACAAG RDmic M. microti RDseal seal-isolates oxyR n285 GA RD 12 oryx-isolates RD 13 goat-isolates pncA 57CACGAC RD 4 M. bovis “classical” RD 1 BCG Tokyo RD 2 BCG Pasteur RD 14 Rapid ID of TB bacilli

  19. RDcan M. canettii “ancestral” TbD 1 RD 9 M. tub. katG 463 CTGCGG “modern” RD9- gyrA 95AGCACC RD 7 RD 8 RD4- RD 10 M. africanum mmpL6 551AACAAG RDmic M. microti RDseal seal oxyR n285 GA RD 12 oryx RD 13 goat pncA 57CACGAC RD 4 M. bovis “classical” RD 1 BCG Tokyo RD 2 RD 14 BCG Pasteur Rapid ID of TB bacilli

  20. RDcan M. canettii “ancestral” TbD 1 RD 9 M. tub. katG 463 CTGCGG “modern” RD9- gyrA 95AGCACC RD 7 RD1- RD 8 RD 10 M. africanum mmpL6 551AACAAG RDmic M. microti RDseal seal oxyR n285 GA RD 12 oryx RD 13 goat pncA 57CACGAC RD 4 M. bovis “classical” RD 1 RD 2 RD 14 BCG Rapid ID of TB bacilli

  21. Evolution of the M. tb complex M. bovis X M. tuberculosis

  22. Evolution of the M. tb complex M. bovis M. tuberculosis Progenitor bacillus

  23. Has M. tb evolved since? Different approaches to population genetics All based on genomics

  24. Mycobacterium canettii issmooth M. canettii M. tuberculosis

  25. M. prototuberculosis Split decomposition analysis, SNP data MTBC (worldwide) M. canettii Smooth tubercle bacilli (Djibouti, East Africa)

  26. LSP (RD) typing Gagneux et al. (2006) Variable host-pathogen compatibility in M. tuberculosis. Proc Natl Acad Sci U S A; 103: 2869-2873.

  27. SNP typing - 1 Baker et al. (2004) Silent nucleotide polymorphisms and a phylogeny for Mycobacterium tuberculosis. Emerg Infect Dis 2004; 10: 1568-77. Examined 37 sSNPs in 225 isolates

  28. SNP typing - 2 36 sSNPs in 5069 isolates Gutacker et al. (2006) Single-nucleotide polymorphism-based population genetic analysis of Mycobacterium tuberculosis strains from 4 geographic sites. J Infect Dis; 193: 121-128.

  29. SNP typing - 3 Studied 159 sSNPs in 219 isolates

  30. Global distribution Red Euro-American Green W-African 1 Brown W-African 2 Yellow Indo-Oceanic Purple EA-Indian Blue East Asian Blue is most worrying

  31. The Beijing family Appears to be more virulent, more transmissible & associated with MDR TRENDS in Microbiology Vol.10 No.1 January 2002 45-52

  32. Beijing phylogeny Marmiesse et al. (2004) Microbiology 150: 483 - 496

  33. A new lipid - PGL - in Beijing Reed et al. (2004) Nature 431: 84-87

  34. Immunocompetent mice, aerosol infection Effect of PGL on virulence Reed et al. (2004) Nature 431: 84-87

  35. Immunologic effects of PGL Reed et al. (2004) Nature 431: 84-87

  36. Further immunologic effects Single sugar accounts for difference Reed et al. (2004) Nature 431: 84-87

  37. PGL impacts on phenotype • Increases lethality greatly but not bacterial load • Down-regulates pro-inflammatory response in dose-dependent manner • Represses TNF-alpha, IL-6 & IL-12 production • May contribute to increased transmission Reed et al. (2004) Nature 431: 84-87

  38. Summary • M. tuberculosis complex tightly knit but differences in host range • M. tuberculosis not descended from M. bovis but possibly from M. prototuberculosis • Species became host adapted. 4-5 major M.tb groups • Hypervirulent variants emerge and replace existing clones

  39. With the participation of... Institut Pasteur R. Brosch S. Brisse M-C. Gutierrez T. Garnier N. Honoré M. Marmiesse V. Vincent WT Sanger Institute B.G. Barrell J. Parkhill M-A. Rajandream NIH NIAID ILEP Central Veterinary Lab. R.G. Hewinson S.V. Gordon

More Related